SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 14 of 14
Search took 0.00 seconds.
Search: Posts Made By: axiom7
Forum: Bioinformatics 03-15-2012, 12:57 PM
Replies: 4
Views: 2,074
Posted By axiom7
Hi, Did you ever figure this out. I am having the...

Hi, Did you ever figure this out. I am having the exact same problem.
Thanks.
Susan
Forum: General 03-15-2012, 12:47 PM
Replies: 2
Views: 1,462
Posted By axiom7
I take it back. It seems as if Align.pl does not...

I take it back. It seems as if Align.pl does not like the fastq file itself.
Forum: General 03-15-2012, 12:28 PM
Replies: 2
Views: 1,462
Posted By axiom7
Problem running cb_local; maybe manifest file?

Hi,
I am trying to run crossbow against a local fastq file that I have. I downloaded the hg18.jar file and I believe everything (or most everything) is configured correctly.

The command I execute...
Forum: Bioinformatics 01-26-2011, 01:43 PM
Replies: 0
Views: 2,066
Posted By axiom7
soap2 PE results do not match bowtie or novoalign

Hi,

Here are the two fasta files:


cat 0000002435.1.fa
>0000002435
CTGGCCAACATGGTGAAACC
cat 0000002435.2.fa
>0000002435
Forum: Bioinformatics 07-27-2010, 01:10 PM
Replies: 514
Views: 223,079
Posted By axiom7
Regarding the disparate -m1 vs -a

Thanks for a reply,

I posted the input reads so that someone could run bowtie using that input against human chromosome #1 and see the results for themselves, as it is so small and easily done. ...
Forum: Bioinformatics 07-27-2010, 07:05 AM
Replies: 514
Views: 223,079
Posted By axiom7
Red face More on disparate results between -a vs -m1

Hi all,
I thought I asked a reasonable question...
Susan
Forum: Bioinformatics 07-20-2010, 12:30 PM
Replies: 514
Views: 223,079
Posted By axiom7
More on disparate results between -a vs -m1

Hi again,

Have not gotten any reply to my posting, so I thought I'd make it a little easier for you. I am pasting the --12, 10-line input file and the two commands which quickly and easily...
Forum: Bioinformatics 07-15-2010, 01:28 PM
Replies: 514
Views: 223,079
Posted By axiom7
Disparate results between -m1 and -a

Hi,

I have some paired end data generated from human chromosome 1. Pairs are between 700 and 1300 bases apart. I have cut 10 pairs from the overall data to run some tests to try and understand...
Forum: Bioinformatics 11-03-2009, 10:44 AM
Replies: 3
Views: 8,485
Posted By axiom7
Samtools "is recognized as '*'" "truncated file" error

Hi,

I posted this last week to the samtools thread, but did not receive a reply, so I'm taking another stab at it:

samtools-0.1.6_x86_64-linux; precompiled version downloaded today

$ bowtie...
Forum: Bioinformatics 10-29-2009, 11:34 AM
Replies: 292
Views: 159,925
Posted By axiom7
Hi, samtools-0.1.6_x86_64-linux; precompiled...

Hi,

samtools-0.1.6_x86_64-linux; precompiled version downloaded today

$ bowtie --version
bowtie version 0.11.3
64-bit
Built on myserver
Fri Oct 23 13:27:05 MDT 2009
Compiler: gcc version...
Forum: Bioinformatics 10-27-2009, 09:24 AM
Replies: 514
Views: 223,079
Posted By axiom7
Red face Sorry, I meant using -e 210 to simulate - not -3...

Sorry, I meant using -e 210 to simulate - not -3 210.

Susan
Forum: Bioinformatics 10-23-2009, 08:18 AM
Replies: 514
Views: 223,079
Posted By axiom7
Hi Ben, I just wanted to follow up on my...

Hi Ben,

I just wanted to follow up on my original question regarding using -v n, where n>3 which I posted 10/16/09. I am satisfied with your solution. In fact I find that the results of using -v...
Forum: Bioinformatics 10-16-2009, 07:08 AM
Replies: 514
Views: 223,079
Posted By axiom7
Ben and sparks, Thanks for all the input. I...

Ben and sparks,

Thanks for all the input. I will be working on this today and will respond back to you.

Susan
Forum: Bioinformatics 10-15-2009, 12:19 PM
Replies: 514
Views: 223,079
Posted By axiom7
Polonator data with gaps

Hi Ben,
I have some output from a Polonator. This is paired-end data with gaps. For instance, the raw data is 26 base pairs. The researcher asserts this to be 2x15mers with a gap of two...
Showing results 1 to 14 of 14

 


All times are GMT -8. The time now is 10:52 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO