SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 5 of 5
Search took 0.00 seconds.
Search: Posts Made By: LijunZ
Forum: Metagenomics 03-16-2017, 10:47 AM
Replies: 8
Views: 1,912
Posted By LijunZ
Thanks Brian and thermophile: Actually I use...

Thanks Brian and thermophile:

Actually I use cutadapt to grep designed primer, and allowed 2 mismatch over primer for degenerated bases. then remove reverse complementary primer in the same reads....
Forum: Metagenomics 03-16-2017, 07:18 AM
Replies: 8
Views: 1,912
Posted By LijunZ
Thanks thermophile: You are right, we are...

Thanks thermophile:

You are right, we are using 27F for V1, and position 534-518 (ATTACCGCGGCTGCTGG) for V3. I put typo as 173F.

if I check V1 primer, I can get around 47% reads:

grep...
Forum: Metagenomics 03-16-2017, 06:58 AM
Replies: 8
Views: 1,912
Posted By LijunZ
Thanks Brian: I have tried to merge pair reads,...

Thanks Brian:
I have tried to merge pair reads, actually, we did two experiences to cover V1-3 and V3-5 regions for the same samples with over 1million reads pairs. However we didn't get enough...
Forum: Metagenomics 03-15-2017, 09:18 AM
Replies: 8
Views: 1,912
Posted By LijunZ
How to extract subregions from Miseq 16srRNA data?

We did 2X300 pair end sequence with Miseq to cover V1-V3 regions of 16srRNA. We use primer 27F (AGAGTTTGATCATGGCTCAG) for V1, and position 534-518 R (ATTACCGCGGCTGCTGG) for V3 regions.

Now, if I...
Forum: Introductions 02-20-2017, 07:40 AM
Replies: 0
Hi
Views: 637
Posted By LijunZ
Hi

I am a bioinformatics, glad to have a forum here.
Showing results 1 to 5 of 5

 


All times are GMT -8. The time now is 08:36 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO