Forum: Sample Prep / Library Generation
10-02-2020, 07:38 PM
|
Replies: 5
Views: 1,573
|
Forum: Sample Prep / Library Generation
10-01-2020, 05:29 AM
|
Replies: 3
Views: 1,202
|
Forum: Bioinformatics
04-02-2020, 12:39 PM
|
Replies: 19
Views: 1,701
|
Forum: Bioinformatics
04-02-2020, 10:03 AM
|
Replies: 19
Views: 1,701
|
Forum: Illumina/Solexa
03-05-2020, 05:02 PM
|
Replies: 2
Views: 1,412
|
Forum: Sample Prep / Library Generation
10-30-2019, 03:22 PM
|
Replies: 2
Views: 1,820
|
Forum: Illumina/Solexa
10-23-2019, 05:01 PM
|
Replies: 6
Views: 1,950
|
Forum: Illumina/Solexa
04-27-2019, 02:52 PM
|
Replies: 3
Views: 2,008
This true of libraries with Y shaped adapters...
This true of libraries with Y shaped adapters prior to PCR, but after PCR won't there also be strands that contain the complements to the original adapter sequences? So for a double stranded library...
|
Forum: Illumina/Solexa
04-10-2019, 05:49 PM
|
Replies: 3
Views: 1,621
|
Forum: Illumina/Solexa
04-10-2019, 05:05 PM
|
Replies: 3
Views: 1,621
The I5 index chemistry for the HiSeqX is...
The I5 index chemistry for the HiSeqX is different from the NovaSeq. For standard TruSeq style adapters the I5 sequence on the HiSeqX will be the reverse complement of what it is for the NovaSeq.
...
|
Forum: Sample Prep / Library Generation
08-27-2018, 08:41 PM
|
Replies: 12
Views: 80,544
|
Forum: Epigenetics
05-18-2018, 04:05 PM
|
Replies: 17
Views: 12,624
@Castrolsc The digestion profile will vary by...
@Castrolsc The digestion profile will vary by sample type, but it looks like the digestion for your Sperm DNA worked fine. There is material in the range you need for library generation, and the...
|
Forum: Metagenomics
04-15-2018, 10:49 AM
|
Replies: 13
Views: 7,642
It looks like your Q scores have a big drop at...
It looks like your Q scores have a big drop at ~80bp which indicates that you have a lot of smaller than expected library fragments. Since you are sequencing v3-v4 libraries I would guess this is due...
|
Forum: Illumina/Solexa
02-17-2018, 07:21 AM
|
Replies: 5
Views: 1,831
|
Forum: RNA Sequencing
09-27-2017, 07:18 AM
|
Replies: 7
Views: 1,705
|
Forum: Illumina/Solexa
09-25-2017, 12:41 PM
|
Replies: 3
Views: 1,859
Hello Svitlana
I looked at this sequence from...
Hello Svitlana
I looked at this sequence from your other post http://seqanswers.com/forums/showthread.php?t=78247 and the reverse complement matches TruSeq Process controls CTA-150bp, CTA-450bp,...
|
Forum: Illumina/Solexa
09-22-2017, 06:22 PM
|
Replies: 11
Views: 1,708
Looks like the reverse complement of #3...
Looks like the reverse complement of #3 (GCGGCCGCGATATCCTGCAGATGCATCCAGTACTAGTATGGCCC) matches the last 55 base of TruSeq process controls CTA-150bp, CTA-450bp, CTA-550bp, and CTA-850bp
|
Forum: Bioinformatics
09-19-2017, 08:44 AM
|
Replies: 5
Views: 1,845
|
Forum: Sample Prep / Library Generation
08-12-2017, 09:12 AM
|
Replies: 11
Views: 4,466
|
Forum: Illumina/Solexa
05-10-2017, 08:19 PM
|
Replies: 2
Views: 2,829
|
Forum: Illumina/Solexa
04-20-2017, 12:45 PM
|
Replies: 5
Views: 1,654
I don't have any hands on experience with the...
I don't have any hands on experience with the NextSeq, but there seems to be a tendency for NextSeq data to have more polyG sequences in R2 than in R1. Possibly due to some inefficiency in the Read 2...
|
Forum: General
03-27-2017, 08:59 PM
|
Replies: 2
Views: 1,383
|
Forum: Bioinformatics
02-10-2017, 08:11 PM
|
Replies: 4
Views: 3,974
|
Forum: General
02-04-2017, 01:20 PM
|
Replies: 4
Views: 2,972
|
Forum: Illumina/Solexa
02-01-2017, 08:12 PM
|
Replies: 14
Views: 4,518
If you mean that your library inserts will...
If you mean that your library inserts will contain inline barcodes (I assume at the beginning of your R1 and R2 read) that you will use to demultiplex, then yes you can omit the index read.
|