SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read


Showing results 1 to 16 of 16
Search took 0.00 seconds. Search: Posts Made By: gridbird
Forum: Academic/Non-Profit Jobs 04-20-2012, 10:24 AM
Replies: 2
Views: 2,346
Posted By gridbird
is it a postdoc position?

is it a postdoc position?
Forum: Metagenomics 03-26-2012, 11:09 AM
Replies: 4
Views: 3,725
Posted By gridbird
Hi Colindaven, it is a good idea. We really did...

Hi Colindaven, it is a good idea. We really did several tests using CD-HIT before. We got better assembly results than original dataset. did you also use CD-HIT for assembly test?
Forum: Bioinformatics 01-12-2012, 10:25 AM
Replies: 3
Views: 2,231
Posted By gridbird
try "-large" parameter for higher abundance data....

try "-large" parameter for higher abundance data. It may speed up.
Forum: Metagenomics 12-21-2011, 10:24 AM
Replies: 4
Views: 3,725
Posted By gridbird
ABYSS assembler can be used for huge data...

ABYSS assembler can be used for huge data assembly.
Forum: Metagenomics 12-21-2011, 10:22 AM
Replies: 12
Views: 6,121
Posted By gridbird
You can try WebMGA:...

You can try WebMGA: http://weizhong-lab.ucsd.edu/metagenomic-analysis/
Forum: Illumina/Solexa 08-04-2011, 10:05 AM
Replies: 4
Views: 5,709
Posted By gridbird
Thanks for help!!

Thanks for help!!
Forum: Illumina/Solexa 08-03-2011, 05:39 PM
Replies: 4
Views: 5,709
Posted By gridbird
about illumina reads quality score

I got sequencing reads like this:

@HWI-ST644:68:D06CMACXX:3:1101:2217:2245 1:N:0:CGATGT
TATTATGGGCGCACTGAAGGTGTAGAAACTGCCGTCCTCCGTGATGACGGACATATTCGTTTCGTTGGGAAAATTCCTTACGGTAGCCTTCACACGGATG
+...
Forum: Literature Watch 07-25-2011, 04:58 PM
Replies: 2
Views: 2,273
Posted By gridbird
Actually, I never used allpaths/allpaths-lg...

Actually, I never used allpaths/allpaths-lg because it is not easy to use.
Forum: Metagenomics 05-24-2011, 10:50 AM
Replies: 8
Views: 4,540
Posted By gridbird
Newbler is super slow if you can not use correct...

Newbler is super slow if you can not use correct parameters.
for example, "-large" for higher abundance data.
Forum: Bioinformatics 04-22-2011, 05:32 PM
Replies: 4
Views: 2,326
Posted By gridbird
I don't know the corresponding between contigs...

I don't know the corresponding between contigs and scaffold contigs. how do I write script? what is the input of this script?
Forum: Illumina/Solexa 03-21-2011, 05:19 PM
Replies: 2
Views: 10,444
Posted By gridbird
where to find GA pipeline? is it free to use? I...

where to find GA pipeline? is it free to use? I want to remove low quality reads from SRA.
Forum: De novo discovery 02-25-2011, 09:46 AM
Replies: 12
Views: 9,174
Posted By gridbird
I think it is the sequencing error which give you...

I think it is the sequencing error which give you this problem. There is no good N50 for Velvet with high coverage and sequencing error. did you check velvet paper? for error free reads, Velvet can...
Forum: Metagenomics 02-09-2011, 11:29 AM
Replies: 8
Views: 4,540
Posted By gridbird
For 454 pyrosequencing metagenomic data, you...

For 454 pyrosequencing metagenomic data, you should use newbler.
Forum: De novo discovery 02-09-2011, 10:43 AM
Replies: 12
Views: 9,174
Posted By gridbird
what is your read length? and the estimated...

what is your read length? and the estimated genome length? if the sequencing coverage is very high (>=200) and uneven, the N50 is very slow for Velvet because of the sequencing errors and SNPs ， even...
Forum: De novo discovery 02-09-2011, 10:32 AM
Replies: 4
Views: 5,530
Posted By gridbird
how to get the genome coverage of assembly result

I want to get the genome coverage of assembly contigs.
This is a simulated dataset , so I have reference genome.
I got assembly contigs using Velvet, but I don't know how the contig is correct or...
Forum: Illumina/Solexa 10-06-2010, 03:02 PM
Replies: 1
Views: 3,490
Posted By gridbird
fastb format

does anyone know the format "fastb"? I want to get fastq format data but below the link, there are a lot of "fastb" and "qualb" format data. how can I transfer these formats to fastq data?
...
Showing results 1 to 16 of 16

 


All times are GMT -8. The time now is 12:49 AM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO