SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 10 of 10
Search took 0.02 seconds.
Search: Posts Made By: tarias
Forum: Bioinformatics 12-06-2018, 01:56 PM
Replies: 1
Views: 701
Posted By tarias
De novo genome assembly question: which assembly should I use?

I have sequenced two individuals and done three libraries per individual each with a different insert size (170, 500, 800).Using flow citometry I know this genome is 332MB. Also I know is diploid and...
Forum: Bioinformatics 11-24-2015, 02:04 PM
Replies: 132
Views: 68,523
Posted By tarias
Hi, I have been using this program to merge...

Hi,
I have been using this program to merge reads but have not been able to generate a file with only the unmerged reads, any ideas on how to do this? thanks
Forum: RNA Sequencing 08-25-2015, 05:59 AM
Replies: 0
Views: 846
Posted By tarias
Using Kal's test for DE

Hi all,
I have been using Kals test on CLC to calculate DE. I did not find any DE after running the test and using a corrected P-Value FDR cut off of <0.05. Im not sure why I did not find any...
Forum: Bioinformatics 04-08-2015, 05:37 PM
Replies: 1
Views: 953
Posted By tarias
Question about stand alone blast for linux

can the output formats of a blastx file be changed after analysis done with the default -outfmt 0 format? Im using the stand alone blast 2.2.30 and already ran the program for a couple of days...
Forum: Bioinformatics 03-20-2015, 12:38 PM
Replies: 1
Views: 916
Posted By tarias
P5-build genome assembly

Im having troubles understanding what a P5-build genome assembly or a fifth genome build means. Could anyone clarify this for me?
In general Im not really understanding well this whole thing:

The...
Forum: Bioinformatics 09-07-2012, 10:09 AM
Replies: 33
Views: 12,203
Posted By tarias
I did both and getting erros dump in the screen. ...

I did both and getting erros dump in the screen.

mu-166002:Desktop pireslab$ ./filter.pl TA16.txt > filtered.txt
Seq AAGGGGATACATTAGTTACATTTATATATGAAAAATCGAGATCCGGTGATATAACCCAAGGTCTTCCAAAAGTAGA
...
Forum: Bioinformatics 09-07-2012, 09:09 AM
Replies: 33
Views: 12,203
Posted By tarias
Im trying to use this perl script but I don't...

Im trying to use this perl script but I don't know who to pipe my input file through this and get an output file with the good fastq file.
Thanks,
Tatiana
Forum: Bioinformatics 09-23-2011, 08:29 AM
Replies: 3
Views: 1,982
Posted By tarias
cleaning cp, mt and rRNA from reads

Can anyone help me to figure out how to clean my raw reads from cp, mt and rRNA reads? I have Hi-seq data for RNA samples.
Forum: Bioinformatics 09-21-2011, 06:37 PM
Replies: 4
Views: 2,417
Posted By tarias
Thanks, I will try the SolexaQA package, Galaxy...

Thanks, I will try the SolexaQA package, Galaxy takes too long to download my data to the web site and to install Fastx in my computer is more complicated that what I thought!
Forum: Bioinformatics 09-21-2011, 04:50 PM
Replies: 4
Views: 2,417
Posted By tarias
Looking for an perl script to quality trimming data

I'm looking for an easy to use perl script for quality trim my Hi-seq reads (fastaq format).
Thanks
Showing results 1 to 10 of 10

 


All times are GMT -8. The time now is 06:00 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO