
Go Back   SEQanswers > Search Forums

Showing results 1 to 25 of 113
Search took 0.02 seconds.
Search: Posts Made By: cmbetts
Forum: Illumina/Solexa 03-26-2020, 10:58 AM
Replies: 2
Views: 400
Posted By cmbetts
It depends on your amplicon length and what...

It depends on your amplicon length and what you're trying to learn about it.

If it's shorter than ~500bp, you can amplify it directly with PCR primers with flanking Illumina adapter sequences, but...
Forum: RNA Sequencing 12-02-2019, 10:13 AM
Replies: 6
Views: 3,358
Posted By cmbetts
Color by first strand in pair and pick a...

Color by first strand in pair and pick a housekeeping gene (actin, GAPDH, etc). If you see roughly equal color mix, nondirectional. Nearly all the same color, directional with the protocol...
Forum: RNA Sequencing 11-21-2019, 08:36 AM
Replies: 4
Views: 1,182
Posted By cmbetts
Whoops. Same conclusion though. Gs are still...

Whoops. Same conclusion though. Gs are still the dark channel in the iSeq chemistry
Forum: RNA Sequencing 11-20-2019, 02:29 PM
Replies: 4
Views: 1,182
Posted By cmbetts
I take it these are NextSeq or NovaSeq? This...

I take it these are NextSeq or NovaSeq?

This is an adapter dimer that's read through the p7 sequence (ATCTCGTATGCCGTCTTCTGCTTG) into the FC and started spitting out Gs because no template = no...
Forum: Sample Prep / Library Generation 10-08-2019, 02:47 PM
Replies: 3
Views: 946
Posted By cmbetts
By bad annotation, I mean that the...

By bad annotation, I mean that the polyadenylation sites in RefSeq/Gencode are often incorrect, which can make it difficult to amplify the 3'UTR (Refseq in particular tends to choose the longest 3'...
Forum: Sample Prep / Library Generation 10-07-2019, 03:33 PM
Replies: 3
Views: 946
Posted By cmbetts
1. Sure, you can swap in different length RT...

1. Sure, you can swap in different length RT primers without a noticeable impact on performance
2. SSII is definitely better than SSIII, but I don't know about IV
3. I personally like Takara's...
Forum: General 10-01-2019, 12:57 PM
Replies: 6
Views: 2,614
Posted By cmbetts
Again, it's highly dependent on your situation. ...

Again, it's highly dependent on your situation.

You'll need to either buy a ssDNA library kit (usually a minimum 12rxn size) or put something homebrew together based on a published protocol. which...
Forum: General 09-30-2019, 11:48 AM
Replies: 6
Views: 2,614
Posted By cmbetts
Yes, but with levels of difficulty ranging from...

Yes, but with levels of difficulty ranging from trivial to very difficult. If they're for an NGS related application, there's a good chance they're just common primers you can pick from a catalogue...
Forum: Ion Torrent 08-02-2019, 08:22 AM
Replies: 19
Views: 6,975
Posted By cmbetts
Is there a reason you need your own sequencer? ...

Is there a reason you need your own sequencer? You're highly unlikely to ever break even vs making homebrew Illumina libraries and sending them to a service facility that will pool them onto a...
Forum: Sample Prep / Library Generation 05-22-2019, 09:19 AM
Replies: 2
Views: 1,092
Posted By cmbetts
The FA/BA is probably a more accurate measurement...

The FA/BA is probably a more accurate measurement (although I trust qubit more for concentrations >1ng/ul). It's easy to get background readings of 0.1-0.3ng/ul by qubit. Did you run a negative...
Forum: General 05-14-2019, 04:05 PM
Replies: 1
Views: 1,908
Posted By cmbetts
Well that sure cleared up how to translate from...

Well that sure cleared up how to translate from one programming language from another...

Your PI probably wants it in Perl because they can read/write Perl, but not Python and want to double check...
Forum: Sample Prep / Library Generation 04-05-2019, 01:41 PM
Replies: 3
Views: 694
Posted By cmbetts
Take a page out of old school RACE (or...

Take a page out of old school RACE (or Tang/Quartz scRNA-Seq for a more modern example). Add a homopolymer tail using TdT, perform second strand with a complementary primer also with a defined tag,...
Forum: Sample Prep / Library Generation 04-05-2019, 01:21 PM
Replies: 10
Views: 1,496
Posted By cmbetts
Template switching definitely doesn't need a 5'...

Template switching definitely doesn't need a 5' cap to work. Clontech's (Takara) SMARTer stranded kits all use template switching on chemically fragmented RNA with random priming. The internal...
Forum: Bioinformatics 04-01-2019, 11:22 AM
Replies: 7
Views: 880
Posted By cmbetts
That sequence isn't derived from the fragment...

That sequence isn't derived from the fragment you're trying to sequence. 100% of it was chemically synthesized by your oligo synthesis company. It match close enough to your insert of interest to...
Forum: Sample Prep / Library Generation 03-01-2019, 09:31 AM
Replies: 10
Views: 1,496
Posted By cmbetts
I'd start with as SMARTseq2 like protocol as fits...

I'd start with as SMARTseq2 like protocol as fits with your design and optimize from there.
I can't go too much in the black magic parts (former Clontech/Takara employee, and still friendly with...
Forum: Sample Prep / Library Generation 03-01-2019, 09:10 AM
Replies: 10
Views: 1,496
Posted By cmbetts
Are you using default SSII buffer? MgCl2 levels...

Are you using default SSII buffer? MgCl2 levels are very important for TS, and higher than most standard buffers.
Forum: RNA Sequencing 02-28-2019, 04:51 PM
Replies: 2
Views: 1,470
Posted By cmbetts
I'd be careful about using them for Prokaryotes. ...

I'd be careful about using them for Prokaryotes. Many of them are actually bacterial genes, mostly B.subtilis if I remember correctly, but also some antibiotic resistance genes descended from Affy...
Forum: General 02-14-2019, 12:52 PM
Replies: 1
Views: 1,667
Posted By cmbetts
Very doable, although random priming isn't...

Very doable, although random priming isn't necessary for second strand if you're using standard Gubler-Hoffman, the RNaseH handles the priming. This Nature Methods paper from the Broad should give...
Forum: Sample Prep / Library Generation 12-19-2018, 02:49 PM
Replies: 15
Views: 19,254
Posted By cmbetts
Any polymerase with 3' Exonuclease activity can...

Any polymerase with 3' Exonuclease activity can do end repair in the presence of nucleotides, which would include many PCR polymerases. Here's a paper using Pfu for old school cloning...
Forum: Bioinformatics 11-26-2018, 03:47 PM
Replies: 2
Views: 1,001
Posted By cmbetts
The way I handled it in the past was to build my...

The way I handled it in the past was to build my STAR index with both genomes/annotations simultaneously making sure to rename the chromosomes such that they're unique ("human_chr1" and "mouse_chr1"...
Forum: Bioinformatics 11-01-2018, 04:21 PM
Replies: 1
Views: 721
Posted By cmbetts
It looks like the BAM Analysis Kit software is...

It looks like the BAM Analysis Kit software is trying to do a whole lot more than generating a VCF file (replicating commercial genealogy reports). If what you need is a VCF file, there are many...
Forum: Sample Prep / Library Generation 11-01-2018, 04:10 PM
Replies: 3
Views: 1,056
Posted By cmbetts
Probably fine. DNA is pretty stable at RT in...

Probably fine. DNA is pretty stable at RT in standard storage buffers. You can always verify the accuracy by rerunning some previously quanted samples.
Forum: RNA Sequencing 06-21-2018, 01:23 PM
Replies: 2
Views: 1,508
Posted By cmbetts
Have you verified with your sequencing provider...

Have you verified with your sequencing provider that they gave you the right data back? I've previously had a vender return another user's data to me. Luckily, we had used a custom protocol and it...
Forum: Sample Prep / Library Generation 06-08-2018, 08:59 AM
Replies: 282
Views: 136,269
Posted By cmbetts
There's tons of low MW products there indicating...

There's tons of low MW products there indicating massive RNA degradation, which you have in both your cell and purified RNA samples. Did you check the RIN of your pure RNA? If it's high, then...
Forum: Sample Prep / Library Generation 05-16-2018, 02:44 PM
Replies: 4
Views: 1,574
Posted By cmbetts
That protocol looks like a scaled down version of...

That protocol looks like a scaled down version of the various homebrew AmpureXP recipes out there. It's probably a cost savings measure to avoid the premium on the real deal. I'd agree with the...
Showing results 1 to 25 of 113


All times are GMT -8. The time now is 11:32 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO