Forum: Sample Prep / Library Generation
01-11-2018, 06:08 AM
|
Replies: 2
Views: 2,153
Indeed there are 20 million possible...
Indeed there are 20 million possible interactions, but in reality the number is much smaller. The reason for large volumes and large number of cycles is therefore to have more specific PCR product...
|
Forum: Illumina/Solexa
01-11-2018, 04:18 AM
|
Replies: 0
Views: 779
T over-representation in NextSeq500 run
Hello, we got strange results from some of the recent RNA-seq runs on NextSeq500; example: 5039
Funny is that we have observed it in some runs while other runs from the same experiment (all...
|
Forum: Illumina/Solexa
03-08-2015, 10:44 AM
|
Replies: 7
Views: 4,281
|
Forum: Illumina/Solexa
11-05-2014, 07:29 AM
|
Replies: 7
Views: 4,281
|
Forum: Illumina/Solexa
11-04-2014, 05:43 AM
|
Replies: 7
Views: 4,281
4C-seq with Truseq adapters on Nextseq500 problem
I tried to do some 4C sequencing pilots on Nextseq500 platform. I've used these primers to finally amplify my library before sequencing:
AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCT |...
|
Forum: Literature Watch
03-11-2011, 01:18 PM
|
Replies: 0
Views: 2,969
|
Forum: Literature Watch
11-04-2010, 01:55 PM
|
Replies: 0
Views: 2,170
|