SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 7 of 7
Search took 0.00 seconds.
Search: Posts Made By: Asashoryu
Forum: Sample Prep / Library Generation 01-11-2018, 06:08 AM
Replies: 2
Views: 2,153
Posted By Asashoryu
Indeed there are 20 million possible...

Indeed there are 20 million possible interactions, but in reality the number is much smaller. The reason for large volumes and large number of cycles is therefore to have more specific PCR product...
Forum: Illumina/Solexa 01-11-2018, 04:18 AM
Replies: 0
Views: 779
Posted By Asashoryu
Question T over-representation in NextSeq500 run

Hello, we got strange results from some of the recent RNA-seq runs on NextSeq500; example: 5039

Funny is that we have observed it in some runs while other runs from the same experiment (all...
Forum: Illumina/Solexa 03-08-2015, 10:44 AM
Replies: 7
Views: 4,281
Posted By Asashoryu
Hello, since I had the libraries ready, I...

Hello,

since I had the libraries ready, I sequenced them on HiSeq where they worked perfectly.

M
Forum: Illumina/Solexa 11-05-2014, 07:29 AM
Replies: 7
Views: 4,281
Posted By Asashoryu
Thanks for the reply! Indeed it makes sense now.

Thanks for the reply! Indeed it makes sense now.
Forum: Illumina/Solexa 11-04-2014, 05:43 AM
Replies: 7
Views: 4,281
Posted By Asashoryu
4C-seq with Truseq adapters on Nextseq500 problem

I tried to do some 4C sequencing pilots on Nextseq500 platform. I've used these primers to finally amplify my library before sequencing:

AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCT |...
Forum: Literature Watch 03-11-2011, 01:18 PM
Replies: 0
Views: 2,969
Posted By Asashoryu
Genomic DNA Pooling Strategy for Next-Generation Sequencing-Based Rare Variant Discov

J Cardiovasc Transl Res. 2011 Mar 1.

Genomic DNA Pooling Strategy for Next-Generation Sequencing-Based Rare Variant Discovery in Abdominal Aortic Aneurysm Regions of Interest-Challenges and...
Forum: Literature Watch 11-04-2010, 01:55 PM
Replies: 0
Views: 2,170
Posted By Asashoryu
Mutation discovery by targeted genomic enrichment of multiplexed barcoded samples

Mutation discovery by targeted genomic enrichment of multiplexed barcoded samples.

Nijman IJ, Mokry M, van Boxtel R, Toonen P, de Bruijn E, Cuppen E.

Nat Methods. 2010 Nov;7(11):913-5
...
Showing results 1 to 7 of 7

 


All times are GMT -8. The time now is 07:16 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO