Forum: Illumina/Solexa
12-15-2021, 08:32 AM
|
Replies: 6
Views: 2,240
|
Forum: Illumina/Solexa
12-15-2021, 06:49 AM
|
Replies: 6
Views: 2,240
|
Forum: Illumina/Solexa
12-13-2021, 12:44 PM
|
Replies: 6
Views: 2,240
By "no % PF", do you mean, PF% was zero, or PF%...
By "no % PF", do you mean, PF% was zero, or PF% was not calculated? If the latter, then that is an issue independent of library quality. I have never seen this, but it sounds more like an issue with...
|
Forum: Sample Prep / Library Generation
02-06-2020, 08:52 AM
|
Replies: 21
Views: 10,146
Interesting. Appears to use a...
Interesting. Appears to use a strand-denaturation/hybridization-based normalization to remove/reduce concentrations of highly represented cDNAs. That is, enzymatic digestion of DNA/RNA duplexes that...
|
Forum: Sample Prep / Library Generation
12-22-2019, 09:49 AM
|
Replies: 20
Views: 16,354
|
Forum: Bioinformatics
10-11-2019, 07:25 AM
|
Replies: 3
Views: 1,817
|
Forum: Illumina/Solexa
09-30-2019, 05:34 AM
|
Replies: 2
Views: 2,005
|
Forum: Sample Prep / Library Generation
06-21-2019, 06:44 AM
|
Replies: 5
Views: 4,898
Old school method involved embedding cells in...
Old school method involved embedding cells in agarose and lysing/prepping the DNA in situ. Initially these were just little slabs of agarose. But later moved more to higher surface area collects of...
|
Forum: Bioinformatics
06-12-2019, 11:43 AM
|
Replies: 2
Views: 1,650
|
Forum: Illumina/Solexa
05-07-2019, 12:01 PM
|
Replies: 2
Views: 2,163
|
Forum: Illumina/Solexa
04-18-2019, 08:35 AM
|
Replies: 1
Views: 1,600
|
Forum: Illumina/Solexa
03-25-2019, 07:56 AM
|
Replies: 1
Views: 1,119
The answer is:
The sequence: ...
The answer is:
The sequence:
Oligonucleotide sequences©2017 Illumina,Inc. All rights reserved.
AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGTCCGA
is just the PCR primer and doesn't contain the...
|
Forum: Illumina/Solexa
03-22-2019, 08:10 AM
|
Replies: 1
Views: 1,119
Small RNA adapters skip first 5 bases of R1?
I've now seen a couple of sets of libraries with Illumina "small RNA" adapters that seem to somehow "skip" the first 5 bases of R1. This being being obvious only when comparing the forward and...
|
Forum: Illumina/Solexa
03-07-2019, 10:40 AM
|
Replies: 5
Views: 3,892
Seems like this recent change is more of a...
Seems like this recent change is more of a reversion to the original Illumina plan types. With a very low level coverage for people who pretty much do their own repairs (bronze) and the more standard...
|
Forum: Bioinformatics
03-01-2019, 06:21 AM
|
Replies: 4
Views: 2,087
|
Forum: Bioinformatics
03-01-2019, 02:53 AM
|
Replies: 4
Views: 2,087
Upon being given such a homework assignment, I...
Upon being given such a homework assignment, I would post it on appropriate web forums hoping to find someone gullible enough to save me from answering the question myself.
Wait, no! I would not...
|
Forum: Illumina/Solexa
01-17-2019, 12:04 PM
|
Replies: 1
Views: 1,235
|
Forum: 454 Pyrosequencing
01-14-2019, 08:13 AM
|
Replies: 5
Views: 23,187
|
Forum: 454 Pyrosequencing
01-14-2019, 07:06 AM
|
Replies: 5
Views: 23,187
|
Forum: Illumina/Solexa
12-20-2018, 11:40 AM
|
Replies: 9
Views: 4,342
|
Forum: Illumina/Solexa
12-03-2018, 02:49 AM
|
Replies: 6
Views: 8,061
Impossible to guess what "much less" means in...
Impossible to guess what "much less" means in this context. The previous poster mentioned 100x less -- that is clearly an issue.
Anyway, you will want to contact Illumina technical support. That...
|
Forum: Illumina/Solexa
11-30-2018, 03:30 AM
|
Replies: 3
Views: 3,168
|
Forum: Sample Prep / Library Generation
11-26-2018, 06:40 AM
|
Replies: 4
Views: 1,612
Yes, please everyone switch to blue light...
Yes, please everyone switch to blue light illumination for preparative gels! We did so > 20 years ago. I'm just realizing that many labs (and new PI!) are unaware of the problems UV light damage to...
|
Forum: Illumina/Solexa
11-06-2018, 06:22 AM
|
Replies: 8
Views: 4,935
|
Forum: Illumina/Solexa
11-01-2018, 09:07 AM
|
Replies: 8
Views: 4,935
|