SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 500
Search took 0.04 seconds.
Search: Posts Made By: nucacidhunter
Forum: Illumina/Solexa 11-06-2019, 02:30 PM
Replies: 18
Views: 459
Posted By nucacidhunter
Run stats seems within specs for the library type...

Run stats seems within specs for the library type although they seem to be more cautious. To increase output safely following can be done:
1- Increasing cluster density to around 800k/mm2
2-...
Forum: Illumina/Solexa 11-05-2019, 02:55 AM
Replies: 18
Views: 459
Posted By nucacidhunter
More info for following would be useful: 1- Are...

More info for following would be useful:
1- Are the libraries 6S V regions and overall prep workflow
2- cluster density
3- How many libraries are multiplexed
4- Read output
Forum: Illumina/Solexa 10-29-2019, 04:22 AM
Replies: 7
Views: 435
Posted By nucacidhunter
It should be TruSeq as FastQC would indicate. I...

It should be TruSeq as FastQC would indicate. I am not sure but you can try following:

Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA


Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Forum: Illumina/Solexa 10-29-2019, 12:57 AM
Replies: 7
Views: 435
Posted By nucacidhunter
The library is sequenced on Illumina system so...

The library is sequenced on Illumina system so the adapter sequences for trimming should be the same as Illumina adapters.
Forum: Illumina/Solexa 10-12-2019, 06:55 PM
Replies: 2
Views: 360
Posted By nucacidhunter
Cluster density is above specification but final...

Cluster density is above specification but final results for PF and Q30 looks good. Those thumbnails are specific for selected cycle and base and if you select different base at the same cycle it...
Forum: RNA Sequencing 09-17-2019, 07:56 PM
Replies: 2
Views: 995
Posted By nucacidhunter
RiboFree total RNA-seq library prep from Zymo...

RiboFree total RNA-seq library prep from Zymo Research looks good on paper and does not require species specific depletion step but I have not tried yet:
...
Forum: Sample Prep / Library Generation 09-14-2019, 02:24 AM
Replies: 20
Views: 6,918
Posted By nucacidhunter
Regardless of size distribution, library does not...

Regardless of size distribution, library does not seem to have typical periodicity expected in ATAC-seq libraries indicating that there was ambient DNA in nuclei stock or nuclei disintegrated during...
Forum: Ion Torrent 08-02-2019, 11:52 PM
Replies: 19
Views: 2,416
Posted By nucacidhunter
Following is the link to some OZ sequencing...

Following is the link to some OZ sequencing service providers:

http://www.agrf.org.au/contact-us

https://www.ramaciotti.unsw.edu.au/

http://dna.med.monash.edu.au/

I am sure they all will...
Forum: Ion Torrent 08-02-2019, 06:38 PM
Replies: 19
Views: 2,416
Posted By nucacidhunter
There are several companies in OZ that will...

There are several companies in OZ that will sequence your own prepared libraries. You can PM me if you one a list.
Forum: Illumina/Solexa 07-30-2019, 03:32 AM
Replies: 2
Views: 671
Posted By nucacidhunter
You can use ssDNA library prep method or a kit...

You can use ssDNA library prep method or a kit such as ACCEL-NGS 1S (or
1S Plus) DNA LIBRARY kit.
Forum: Sample Prep / Library Generation 05-25-2019, 06:48 PM
Replies: 1
Views: 767
Posted By nucacidhunter
I would suggest to do a reaction according to...

I would suggest to do a reaction according to standard protocol from start to end and check the resulting library. Tagmented DNA will not migrate according to size becuase:
1- transposon will be...
Forum: Sample Prep / Library Generation 05-23-2019, 08:25 PM
Replies: 4
Views: 863
Posted By nucacidhunter
plexWell 96 or 384 could fit your library prep....

plexWell 96 or 384 could fit your library prep. It seems to be cheap and also quick.

https://seqwell.com/product/pw96/
Forum: Illumina/Solexa 05-05-2019, 04:17 PM
Replies: 11
Views: 1,753
Posted By nucacidhunter
Any non-hot start polymerase will do the gap...

Any non-hot start polymerase will do the gap filling.
Forum: Sample Prep / Library Generation 04-06-2019, 12:09 AM
Replies: 10
Views: 1,204
Posted By nucacidhunter
Using other reverse transcriptase with strand...

Using other reverse transcriptase with strand switching activity (SMARTScribe, Maxima H Minus) might give better results. There are some threads in this site as well under single cell RNA-Seq...
Forum: Sample Prep / Library Generation 04-05-2019, 11:58 PM
Replies: 3
Views: 567
Posted By nucacidhunter
A general approach is to prime RT reaction with a...

A general approach is to prime RT reaction with a random sequences (6-8nt) followed with a defined 5' overhang and then size select the cDNA. Implementing this will depend on downstream application.
Forum: Sample Prep / Library Generation 04-05-2019, 11:45 PM
Replies: 1
Views: 609
Posted By nucacidhunter
If a library is prepared and includes a PCR step...

If a library is prepared and includes a PCR step it should sequence well regardless of input DNA quality. Following can be useful:

1- Treating input DNA with NEB FFPE repair reagents to fix some...
Forum: Illumina/Solexa 04-05-2019, 02:56 AM
Replies: 1
Views: 470
Posted By nucacidhunter
Generally smaller inserts would result in more...

Generally smaller inserts would result in more uniform coverage of genes so for counting applications short inserts are preferred and can be sequenced only 70 cycles. For other applications such as...
Forum: Sample Prep / Library Generation 04-04-2019, 04:25 AM
Replies: 4
Views: 761
Posted By nucacidhunter
Loss of large fragments mostly can be due to...

Loss of large fragments mostly can be due to inefficient binding. longer incubation of bead-DNA solution on a rotating wheel should increase recovery.
Quantifying supernatant with PicoGreen or Qubit...
Forum: Illumina/Solexa 04-04-2019, 04:12 AM
Replies: 5
Views: 975
Posted By nucacidhunter
If you do not need high number of reads, PacBio...

If you do not need high number of reads, PacBio CCS will be a good option as it will cover the whole fragment length with very high accuracy.
Forum: Bioinformatics 03-30-2019, 08:41 PM
Replies: 5
Views: 1,135
Posted By nucacidhunter
It could be result of demultiplexing HiSeq runs....

It could be result of demultiplexing HiSeq runs. i5 index read need to be masked during demultiplexing otherwise the i5 read sequences will be added to 5' end of read 2 (R4).
Forum: Illumina/Solexa 03-07-2019, 01:31 AM
Replies: 5
Views: 951
Posted By nucacidhunter
The fragment size distribution is within optimal...

The fragment size distribution is within optimal for sequence capture if that is what you are doing. To obtain larger fragments (if you are using Nextera not Nextera flex) input DNA need to be...
Forum: Illumina/Solexa 02-24-2019, 11:37 PM
Replies: 5
Views: 951
Posted By nucacidhunter
If you can post Bioanalyser result then it will...

If you can post Bioanalyser result then it will be easier to diagnose the issue.
Forum: Illumina/Solexa 02-21-2019, 02:18 AM
Replies: 11
Views: 1,753
Posted By nucacidhunter
The calculated Tm is correct. Empirically it is...

The calculated Tm is correct. Empirically it is difficult to dissociate that oligo. For an application I tried to inhibit gap filing by both heat and a chemical method. PCR yield was decreased by 65%...
Forum: Illumina/Solexa 02-20-2019, 09:54 PM
Replies: 5
Views: 679
Posted By nucacidhunter
R1 and R2 are sequenced with different primers....

R1 and R2 are sequenced with different primers. Sequencing primers could be one of Illumina sequencing primers or custom primers based on amplicon sequence. The primer choice is based on library prep...
Forum: Illumina/Solexa 02-20-2019, 09:45 PM
Replies: 11
Views: 1,753
Posted By nucacidhunter
Nextera (modified Tn5 transposase) inserts ME...

Nextera (modified Tn5 transposase) inserts ME sequences by cut and paste mechanism and leaves a 9 base gap at the 3' end of insertion site. The gap is filled during 3 min incubation at 72C at PCR...
Showing results 1 to 25 of 500

 


All times are GMT -8. The time now is 01:32 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO