SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 42
Search took 0.00 seconds.
Search: Posts Made By: ge2sasag
Forum: Bioinformatics 09-15-2017, 08:39 AM
Replies: 0
Views: 1,269
Posted By ge2sasag
Homer annotatePeaks.pl could not find full/detailed annotation file

Hi,

I'm trying to annotate some peak files but I'm getting this notification when using annotatePeaks.pl:

Could not find full/detailed annotation file...
Forum: Bioinformatics 07-13-2017, 11:59 AM
Replies: 16
Views: 2,782
Posted By ge2sasag
sure, I will do it! I'm collaborating with...

sure, I will do it! I'm collaborating with another group and they just gave me the files...

I will re-do everything from the beginning and see how it goes.

THANKS!!
Forum: Bioinformatics 07-13-2017, 11:49 AM
Replies: 16
Views: 2,782
Posted By ge2sasag
Maybe that's the reason of the strange things.......

Maybe that's the reason of the strange things.... I was confused by the numbers 1 and 2 in the sample name!! Thanks a lot for your help and time!!!
Forum: Bioinformatics 07-13-2017, 11:40 AM
Replies: 16
Views: 2,782
Posted By ge2sasag
aha! ok thanks for the clarification! an...

aha! ok thanks for the clarification!

an example of original fastq file names:

INPUT_1_130506_BH0HVBADXX_P382_108_index8_1.fastq
INPUT_2_130506_BH0HVBADXX_P382_108_index8_1.fastq
Forum: Bioinformatics 07-13-2017, 11:21 AM
Replies: 16
Views: 2,782
Posted By ge2sasag
But in file 2, there are no reads with 2:N:0 tag,...

But in file 2, there are no reads with 2:N:0 tag, the number 2 is here (in bold):

@HWI-ST1018:141:H0HVBADXX:2:1101:1184:1971 1:N:0:CAGATC CTGATCAGAGGAGGAACATGACTAATCTATGGGCAGCCTACACTGAAGGC +...
Forum: Bioinformatics 07-13-2017, 11:01 AM
Replies: 16
Views: 2,782
Posted By ge2sasag
This is an example of the first reads from...

This is an example of the first reads from TrimGalore output files 1 and 2 (as shown in Galaxy with the "eye" button):

File1:

@HWI-ST1018:141:H0HVBADXX:1:1101:1235:1969 1:N:0:CAGATC...
Forum: Bioinformatics 07-13-2017, 10:21 AM
Replies: 16
Views: 2,782
Posted By ge2sasag
for -I, I used 0, for -X I tried 500 and 1000...

for -I, I used 0, for -X I tried 500 and 1000 with no difference.
Forum: Bioinformatics 07-13-2017, 09:24 AM
Replies: 16
Views: 2,782
Posted By ge2sasag
Any idea?? :(

Any idea?? :(
Forum: Bioinformatics 07-13-2017, 08:55 AM
Replies: 16
Views: 2,782
Posted By ge2sasag
http://imgur.com/a/aFZ1h this is an example...

http://imgur.com/a/aFZ1h

this is an example of how the reads look like
Forum: Bioinformatics 07-13-2017, 08:47 AM
Replies: 16
Views: 2,782
Posted By ge2sasag
Hi GenoMax, thanks for your reply. Both...

Hi GenoMax, thanks for your reply.

Both files were trimmed together with the option paired-end library... that's why I don't know the reason of disconcordant reads....
Forum: Bioinformatics 07-13-2017, 06:35 AM
Replies: 16
Views: 2,782
Posted By ge2sasag
Question >90% aligned concordantly 0 times ChIP-seq Bowtie2

Hi,

I know this question have raised many times here and in other forums but I've tried everything other people suggested in previous posts and still can't figure it out where is the problem.........
Forum: Illumina/Solexa 07-13-2017, 05:04 AM
Replies: 0
Views: 1,209
Posted By ge2sasag
>90% aligned concordantly 0 times ChIP-seq Bowtie2

Hi,

I know this question have raised many times here and in other forums but I've tried everything other people suggested in previous posts and still can't figure it out where is the problem.........
Forum: Epigenetics 10-07-2016, 02:44 AM
Replies: 0
Views: 1,731
Posted By ge2sasag
Correlation of mRNA-methylation pairs

Hi,

I have data from 450K Illumina methylation arrays (average beta values) and microarray (log2FC). I need to compute the correlation and p-value of each CpG-gene pair but I'm not sure how to do...
Forum: Epigenetics 10-23-2014, 04:59 AM
Replies: 53
Views: 8,464
Posted By ge2sasag
ok, sorry, so I shoudnt have added the strand...

ok, sorry, so I shoudnt have added the strand column in this case?

Thank you for your time anyway, I will try to figure it out
Forum: Epigenetics 10-23-2014, 04:50 AM
Replies: 53
Views: 8,464
Posted By ge2sasag
> class(M) [1] "list"

> class(M)
[1] "list"
Forum: Epigenetics 10-23-2014, 04:49 AM
Replies: 53
Views: 8,464
Posted By ge2sasag
> head(M) [[1]] [1] . . . . . . . . . . ....

> head(M)
[[1]]
[1] . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
[58] . . . . . . . . . . . . . . . . . . . . . . . . ....
Forum: Epigenetics 10-23-2014, 04:44 AM
Replies: 53
Views: 8,464
Posted By ge2sasag
> BS <- BSseq(M=M, Cov=Cov, gr=gr, pData=groups,...

> BS <- BSseq(M=M, Cov=Cov, gr=gr, pData=groups, samplesNames=samples)
Error in BSseq(M = M, Cov = Cov, gr = gr, pData = groups, samplesNames = samples) :
unused argument (samplesNames =...
Forum: Epigenetics 10-23-2014, 04:22 AM
Replies: 53
Views: 8,464
Posted By ge2sasag
got this: > M <- sapply(fl, function(x)...

got this:

> M <- sapply(fl, function(x) x$[,4])
Error: unexpected '[' in "M <- sapply(fl, function(x) x$["
Forum: Epigenetics 10-23-2014, 04:11 AM
Replies: 53
Views: 8,464
Posted By ge2sasag
perfect! big thanks! Ill try the bsseq object now

perfect! big thanks! Ill try the bsseq object now
Forum: Epigenetics 10-23-2014, 04:09 AM
Replies: 53
Views: 8,464
Posted By ge2sasag
lets try :)

lets try :)
Forum: Epigenetics 10-23-2014, 03:44 AM
Replies: 53
Views: 8,464
Posted By ge2sasag
I run without errors the code that you wrote me...

I run without errors the code that you wrote me for inserting the column but the output is this:

chr1 564495 1 564496 1
chr1 564501 1 564502 1
chr1 565013 1 565014 1
chr1 565040 1 565041 1...
Forum: Epigenetics 10-23-2014, 03:17 AM
Replies: 53
Views: 8,464
Posted By ge2sasag
thank you very much for your help, Im just...

thank you very much for your help, Im just starting with R but right now Im not able to take any course, I will do it during Christmas vacation when I have more time... but Im pushed to finish...
Forum: Epigenetics 10-23-2014, 02:58 AM
Replies: 53
Views: 8,464
Posted By ge2sasag
which would be the equivalent in R?

which would be the equivalent in R?
Forum: Epigenetics 10-23-2014, 02:43 AM
Replies: 53
Views: 8,464
Posted By ge2sasag
but this command auk is not for R right?

but this command auk is not for R right?
Forum: Epigenetics 10-23-2014, 02:19 AM
Replies: 53
Views: 8,464
Posted By ge2sasag
Maybe, but this is the only thing we have and I...

Maybe, but this is the only thing we have and I have to do it anyway...

should be some like this?:

read.bsmooth("C:\Users\Gema\Desktop", Sample1.bed, seqnames = NULL, returnRAw = FALSE,...
Showing results 1 to 25 of 42

 


All times are GMT -8. The time now is 02:34 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO