SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read


Page 1 of 4 1 23 Last »
Showing results 1 to 25 of 98
Search took 0.02 seconds. Search: Posts Made By: efoss
Forum: Bioinformatics 07-14-2015, 07:13 PM
Replies: 4
Views: 2,541
Posted By efoss
Fantastic! Thanks so much, Richard Finney. ...

Fantastic! Thanks so much, Richard Finney.

As I understand this command, it's saying to filter out anything with a mapping quality (MAPQ) score that is less than one and output that as a bam...
Forum: Bioinformatics 07-14-2015, 02:53 PM
Replies: 4
Views: 2,541
Posted By efoss
removing reads that map to more than one location from gsnap-aligned bam files

I would like to remove reads that map to more than one location from bam files I created using gsnap. Does anyone know how to do this? I would prefer not to have to realign. Also, does anyone know...
Forum: Bioinformatics 03-11-2015, 02:46 PM
Replies: 6
Views: 11,787
Posted By efoss
Hi Genomax, Thanks very much. I really...

Hi Genomax,

Thanks very much. I really appreciate the help.

Eric
Forum: Bioinformatics 03-11-2015, 01:45 PM
Replies: 6
Views: 11,787
Posted By efoss
Hi GenoMax, Thanks very much for the...

Hi GenoMax,

Thanks very much for the suggestion. I followed the instructions and they seemed to work in that the little snippet of test code worked as it should:
...
Forum: Bioinformatics 03-11-2015, 10:25 AM
Replies: 6
Views: 11,787
Posted By efoss
What is a kart file?

In trying to download files from SRA, I was directed to use part of the sratoolkit called "prefetch". There I came across the term "kart file":
...
Forum: Bioinformatics 01-08-2014, 10:44 AM
Replies: 17
Views: 49,539
Posted By efoss
Hi bbm, You might want to try Picard's...

Hi bbm,

You might want to try Picard's AddOrReplaceReadGroups:

http://picard.sourceforge.net/command-line-overview.shtml#AddOrReplaceReadGroups
Forum: Bioinformatics 10-01-2013, 12:19 PM
Replies: 2
Views: 1,160
Posted By efoss
Hi swbarnes2, Thanks very much. This is...

Hi swbarnes2,

Thanks very much. This is really helpful.

Best wishes,

Eric
Forum: Bioinformatics 10-01-2013, 11:47 AM
Replies: 2
Views: 1,160
Posted By efoss
aligners filtering out reads with excessive read depth?

I have RNA seq data for total yeast RNA (not poly-A purified). 90% of my reads should be ribosomal RNA. When aligning with bwa and then looking at read depth at the rDNA using bedtools'...
Forum: Bioinformatics 09-23-2013, 12:03 PM
Replies: 6
Views: 4,329
Posted By efoss
Hi SylvainL, I'm afraid I don't know which...

Hi SylvainL,

I'm afraid I don't know which version it was. I think it was installed on our system in 2011. The one I'm using now is 2.17.0.

Eric
Forum: Bioinformatics 09-20-2013, 01:44 PM
Replies: 6
Views: 4,329
Posted By efoss
Hi kokonech, Thanks for the suggestion. I...

Hi kokonech,

Thanks for the suggestion. I finally figured it out - there was a version of bedtools that had this as a known bug. I updated to the latest version and the problem went away.

I...
Forum: Bioinformatics 09-19-2013, 12:25 PM
Replies: 6
Views: 4,329
Posted By efoss
bedtools coverage is inaccurate

I am using bedtools to calculate coverage in an RNA-seq bam file. I get screwy readings when it encounters a gap where there are no reads. Rather than filling it in with zeros, it takes a value that...
Forum: Bioinformatics 05-11-2013, 02:12 PM
Replies: 9
Views: 12,959
Posted By efoss
Hi CarolW, Sorry - I don't know what to...

Hi CarolW,

Sorry - I don't know what to suggest other than to look very carefully at the name of the index file compared to the name of the bam file.

Good luck.

Eric
Forum: Bioinformatics 05-01-2013, 01:02 PM
Replies: 1
Views: 826
Posted By efoss
And a related question: Has anyone seen a sample...

And a related question: Has anyone seen a sample in which the base calls at sites with both reference and alternate calls going overwhelmingly in favor of reference calls? These are situations where...
Forum: Bioinformatics 05-01-2013, 09:40 AM
Replies: 1
Views: 826
Posted By efoss
preference for aligning to reference over alternate?

Has anyone seen a systematic preference for alignment to the reference sequence over the alternate sequence? It seems like your sequences should preferentially align to the reference genome....
Forum: Bioinformatics 05-01-2013, 09:33 AM
Replies: 0
Views: 726
Posted By efoss
sequencing the silenced X chromosome

Is it more difficult to sequence the silenced X chromosome than the active X chromosome? I would think that all the methylation could easily cause difficulties.

Thanks.

Eric
Forum: Bioinformatics 03-18-2013, 12:31 PM
Replies: 0
Views: 1,876
Posted By efoss
NCBI's decryption tool

I have downloaded some files from NCBI's "Short Read Archive" (SRA). They come in an encrypted format. (The files have the extension "sra.ncbi_enc".) Directions for using this are here:
...
Forum: Bioinformatics 02-01-2013, 04:09 PM
Replies: 3
Views: 2,217
Posted By efoss
Thanks very much for the help. These suggestions...

Thanks very much for the help. These suggestions are really useful.

Best wishes,

Eric
Forum: Bioinformatics 01-31-2013, 05:04 PM
Replies: 3
Views: 2,217
Posted By efoss
quality scores in fastq files extracted from sea files

I extracted some fastq files from sra files. Here are some lines from one of them:

@SRR034473.2 X8097_104:6:1:881:909 length=39
TCAAAAAATGAAGAAGAAGAAAAAAATGAAAAGGGTGCA
+SRR034473.2...
Forum: Bioinformatics 12-24-2012, 04:01 PM
Replies: 4
Views: 2,422
Posted By efoss
Hi aaronh, Thanks very much for the help. I...

Hi aaronh,

Thanks very much for the help. I really appreciate it.

Best wishes,

Eric
Forum: Bioinformatics 12-24-2012, 03:49 PM
Replies: 4
Views: 2,422
Posted By efoss
Hi aaronh, I'm afraid I don't know what the...

Hi aaronh,

I'm afraid I don't know what the tmp dir is. Googling around, it looks like it's a temporary directory used for 'scratch' space. How can I specify it?

Since posting this, I ended...
Forum: Bioinformatics 12-24-2012, 12:51 PM
Replies: 4
Views: 2,422
Posted By efoss
AddOrReplaceReadGroups error (that is probably a more general system or Java error)

In running Picard Tools' AddOrReplaceReadGroups, I got an error that included the following:

Exception in thread "main" net.sf.samtools.util.RuntimeIOException: java.io.IOException: No space left...
Forum: Bioinformatics 12-19-2012, 08:03 PM
Replies: 7
Views: 2,064
Posted By efoss
I found out what the problem is with the 4.3...

I found out what the problem is with the 4.3 billion POS column: There is a bug in the version of gsnap that I was using that can lead to this type of thing with circular chromosomes. (The chromosome...
Forum: Bioinformatics 12-18-2012, 04:32 PM
Replies: 7
Views: 2,064
Posted By efoss
Hi aaronh, Yes, I think it is a Picard bug...

Hi aaronh,

Yes, I think it is a Picard bug as well. I can create bam files from these sam files using samtools' view function just fine.

Eric
Forum: Bioinformatics 12-18-2012, 03:08 PM
Replies: 7
Views: 2,064
Posted By efoss
To follow up on this: The 35M16S CIGAR tells me...

To follow up on this: The 35M16S CIGAR tells me that the read is indeed hanging off the end. (My understanding of hard clipping versus soft clipping is that in both instances, some bases don't match...
Forum: Bioinformatics 12-18-2012, 02:12 PM
Replies: 7
Views: 2,064
Posted By efoss
For what it's worth, here are the two lines that...

For what it's worth, here are the two lines that match that read name:

HWI-ST156_294:2:46:13125:2318:0 99 MT 16336 39 51M = 16539 254 ...
Showing results 1 to 25 of 98
Page 1 of 4 1 23 Last »

 


All times are GMT -8. The time now is 03:40 AM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO