Forum: Bioinformatics
03-23-2014, 10:45 AM
|
|
Replies: 0
Views: 1,996
Extract mapped information from bam files
Hello,
I have 3 bam files that i wanted to compare against each other. For example i have reference file with 10,000 sequences. I have paired end reads sequenced for 3 different samples.
1)...
|
|
Forum: Bioinformatics
02-04-2014, 07:20 AM
|
|
Replies: 3
Views: 2,729
|
|
Forum: Bioinformatics
02-03-2014, 11:18 AM
|
|
Replies: 3
Views: 2,729
normalizing multicov output
Hi..
i used multicov to get read counts for specific genomic regions from different samples. Now, i would like to get expression values for those samples by normalizing the data. Can anyone...
|
|
Forum: Bioinformatics
07-14-2013, 07:09 PM
|
|
Replies: 6
Views: 4,433
|
|
Forum: Bioinformatics
04-25-2013, 07:05 AM
|
|
Replies: 0
Views: 1,254
Archiving/documentation help
Just a quick question.
What software do you use or how do you archive NGS data analysis projects? What meta information regarding to sequencing run and analysis do you store ? Any suggestions on...
|
|
Forum: Bioinformatics
03-20-2013, 10:24 AM
|
|
Replies: 7
Views: 4,065
|
|
Forum: Bioinformatics
02-27-2013, 06:47 PM
|
|
Replies: 7
Views: 4,065
|
|
Forum: Bioinformatics
02-27-2013, 12:37 PM
|
|
Replies: 7
Views: 4,065
Small rna pipeline
hi..
I am working on small rna sequencing which was sequenced through illumina hiseq. the read length i got was 30bp. When i removed 3' adapter, i see that 90% of the reads are having 30bp. I...
|
|
Forum: Bioinformatics
12-06-2012, 06:58 PM
|
|
Replies: 3
Views: 3,718
250bp paired end Miseq reads alignment
Hello all
Recently we upgraded our miseq and got 2*250 run data. Does anyone have experience in aligning this sort of data? I have been using bwa till now for previous runs when it produced 2*150....
|
|
Forum: Bioinformatics
11-28-2012, 05:06 PM
|
|
Replies: 28
Views: 16,971
|
|
Forum: Bioinformatics
08-31-2012, 06:09 AM
|
|
Replies: 1
Views: 2,584
Split fastq file with renaming reads
Hi
I am trying to split fastq file to one read per file seperately and rename the read name. For example
@HBGAIY001A
TGTCTCAACTAATTTAGCCGCAGACCAAGTCTCTGCTACCGT
+HBGAIY001A...
|
|
Forum: Bioinformatics
08-27-2012, 01:12 PM
|
|
Replies: 3
Views: 2,479
Converting 454 reads to illumina reads
Hello
i have a pipeline which works with illumina reads. When i convert the 454 reads in to fastq format and give it as input, the pipeline is not working. The average length of the sequence is...
|
|
Forum: Bioinformatics
08-27-2012, 12:32 PM
|
|
Replies: 4
Views: 2,886
|
|
Forum: Bioinformatics
08-27-2012, 08:23 AM
|
|
Replies: 4
Views: 2,886
Sam / Bam to Ace conversion
Does anyone know how to convert from sam or bam to ace file? i am seeing lot of threads for converting ace to bam but not bam to ace..
|
|
Forum: Bioinformatics
08-23-2012, 06:44 PM
|
|
Replies: 0
Views: 2,732
Haplotype caller
hi..
I have 454 Amplicon sequencing data for a tetraploid potato crop. we have sequenced few genes of interest from several different genotypes. My aim is to seperate genotypes and sub genomes...
|
|
Forum: Bioinformatics
07-02-2012, 09:46 AM
|
|
Replies: 4
Views: 4,801
thank you.. its doing exactly as i asked .. but...
thank you.. its doing exactly as i asked .. but looking at the output i realized that i asked my question wrongly.
I guess i should have made my question clear..sorry about that.. So once the read...
|
|
Forum: Bioinformatics
06-28-2012, 07:15 AM
|
|
Replies: 4
Views: 4,801
Extract base from bam file
I have a bam file and i wanted to extract the following information.
For a read in a bamfile, can i extract the base based on the position? For example, if i say i need the base at 100th position...
|
|
Forum: Bioinformatics
06-25-2012, 01:00 PM
|
|
Replies: 3
Views: 2,151
thankyou for the reply.
jhmc is asking for pcr...
thankyou for the reply.
jhmc is asking for pcr primers as tags. but i dont know the pcr primers. Also i dont see it constructing a haplotype map. all i have is sequencing reads and reference genes...
|
|
Forum: Bioinformatics
06-25-2012, 12:34 PM
|
|
Replies: 3
Views: 2,151
Haplotype calls from Amplicon Sequencing
Hi.. i have data for two groups.. one group has 10 diffent strains and other group has 5 different strains. 40 genes are selected and primers are designed for these genes. Sequencing is performed on...
|
|
Forum: Bioinformatics
06-22-2012, 12:29 PM
|
|
Replies: 2
Views: 2,628
|
|
Forum: RNA Sequencing
06-12-2012, 07:16 AM
|
|
Replies: 2
Views: 2,639
|
|
Forum: RNA Sequencing
06-11-2012, 03:33 PM
|
|
Replies: 2
Views: 2,639
RNA Seq Analysis with multiple samples
Hi..
I have 5 rna seq samples for one group and 10 samples in another group. For this organism there is no reference transcriptome. I have assembled them using trinity and did assembly again by...
|
|
Forum: Bioinformatics
05-22-2012, 06:25 AM
|
|
Replies: 8
Views: 3,007
|
|
Forum: Bioinformatics
05-22-2012, 05:52 AM
|
|
Replies: 8
Views: 3,007
|
|
Forum: Bioinformatics
05-21-2012, 05:21 PM
|
|
Replies: 8
Views: 3,007
|
