SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 7 of 7
Search took 0.00 seconds.
Search: Posts Made By: krispy
Forum: Bioinformatics 03-30-2014, 11:59 PM
Replies: 4
Views: 1,799
Posted By krispy
Hi, I couldn't find a way to increase the memory....

Hi, I couldn't find a way to increase the memory. I have the artemis.jar on my desktop, and I created a shortcut to it. I tried putting in java -mx250m -jar in front of the target field but it just...
Forum: Illumina/Solexa 01-07-2014, 02:41 AM
Replies: 50
Views: 37,249
Posted By krispy
Hi all, I am not sure if I should ask it...

Hi all,

I am not sure if I should ask it here, still new to NGS, and I have lots of questions that I couldn't figured out.

1) I am using a custom adapter (that contains p5 p7 for flow cell...
Forum: Illumina/Solexa 12-25-2013, 12:10 AM
Replies: 3
Views: 3,136
Posted By krispy
Thanks for the reply. :) I actually got the...

Thanks for the reply. :)

I actually got the sequence from the customer letter too (here in: oligonucleotide sequences for the multiplexing sample prep oligo only kit - multiplexing index read...
Forum: Illumina/Solexa 12-24-2013, 10:47 PM
Replies: 3
Views: 3,136
Posted By krispy
MiSeq Index Primer Sequence

Hi all,

I am looking for the exact sequence for the default MiSeq Index Primer. Can anyone help me to check if this is the correct one?

5' GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

and probably...
Forum: Bioinformatics 04-03-2013, 12:05 AM
Replies: 4
Views: 1,981
Posted By krispy
Thanks for the reply! :D But would you mind...

Thanks for the reply! :D

But would you mind further explain what do you mean by "lose the benefit of paired end reads"? Does it mean it will be better if I don't cat the two files into one and...
Forum: Bioinformatics 04-02-2013, 11:57 PM
Replies: 14
Views: 9,343
Posted By krispy
merge gbk files

Hi all, this might sound stupid but I would like to know how to combine multiple genbank files into one continuous file. I tried using <cat> to combine 4 gbk files from 4 chromosomes but when I try...
Forum: Bioinformatics 04-02-2013, 11:27 AM
Replies: 4
Views: 1,981
Posted By krispy
Question Data Analysis Suggestion for a Newbie?

Hi all, I am a newbie in Bioinformatics. I've got data for paired-end DNA sequencing on Illumina platform and I am wondering if anyone is kind enough to give me some suggestions on how to start with...
Showing results 1 to 7 of 7

 


All times are GMT -8. The time now is 01:08 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO