SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 21 of 21
Search took 0.01 seconds.
Search: Posts Made By: proteasome
Forum: 454 Pyrosequencing 10-04-2012, 06:46 AM
Replies: 3
Views: 740
Posted By proteasome
The reduction in ambiguities is a huge advantage...

The reduction in ambiguities is a huge advantage of 454 or any next-gen system. As noted above, we found the multiplexing with the Roche kits to be limiting and cost prohibitive. And the throughput...
Forum: 454 Pyrosequencing 07-25-2012, 08:23 AM
Replies: 6
Views: 966
Posted By proteasome
This is the default MIDconfig.parse file that's...

This is the default MIDconfig.parse file that's included with the software:

/*
**
** MIDConfig.parse
**
** This file contains the multiplex sequences used by the Genome Sequence
** MID...
Forum: 454 Pyrosequencing 04-30-2012, 08:54 AM
Replies: 6
Views: 966
Posted By proteasome
We utilize the sfffile utility (a command line...

We utilize the sfffile utility (a command line tool included with the Roche software) to split the original sff file first by MID, and then by primer sequence.

The first step is to do the primary...
Forum: 454 Pyrosequencing 04-04-2012, 12:55 PM
Replies: 6
Views: 966
Posted By proteasome
I cannot comment on the use of AVA, since I find...

I cannot comment on the use of AVA, since I find it too difficult to use. I use Galaxy instead to define custom workflows for our HLA analysis. I can say from experience that assembly will be...
Forum: 454 Pyrosequencing 03-12-2012, 01:49 PM
Replies: 10
Views: 1,390
Posted By proteasome
I don't buy the tired excuse of small fragment...

I don't buy the tired excuse of small fragment problems leading to bad amplicon sequencing. No matter how many times we SPRI purify and no matter how clean our traces look, we have had many months of...
Forum: 454 Pyrosequencing 02-03-2012, 09:37 AM
Replies: 17
Views: 2,549
Posted By proteasome
I've had issues using the bioanalyzer to both...

I've had issues using the bioanalyzer to both quantify and qualify my products. I'd recommend a picogreen-based quantification method instead of the chip.
Forum: 454 Pyrosequencing 01-31-2012, 12:31 PM
Replies: 3
Views: 1,214
Posted By proteasome
We've seen the same problem: when mixing...

We've seen the same problem: when mixing amplicons, particularly of different sizes, FLX+ has significant issues. I would note that we routinely pool different sized amplicons on a GS-Jr and don't...
Forum: 454 Pyrosequencing 01-31-2012, 12:28 PM
Replies: 7
Views: 1,205
Posted By proteasome
Mis-priming of amplicons during emPCR

Hi guys.

I've been having problems recently with the Roche/454 amplification primers mis-priming my amplicon templates in regions with some weak complimentarity. This is really messing up my data...
Forum: 454 Pyrosequencing 01-31-2012, 12:24 PM
Replies: 3
Views: 740
Posted By proteasome
I'm a little biased, since I do home-brew HLA...

I'm a little biased, since I do home-brew HLA typing with Roche/454 (not using their kits) but I don't think it's possible to add anything to their kits since they come with the primers already added...
Forum: 454 Pyrosequencing 11-01-2011, 10:17 AM
Replies: 6
Views: 1,362
Posted By proteasome
Indeed my previous thread was similar, but in...

Indeed my previous thread was similar, but in that case I was eventually able to turn off most of the filters and find my missing A reads (they were chimeric products generated with one of the Roche...
Forum: 454 Pyrosequencing 10-31-2011, 10:59 AM
Replies: 6
Views: 1,362
Posted By proteasome
View all Raw reads?

I have experience with re-processing 454 data using the custom xml file, but I'm wondering if there's any relatively easy way to pass ALL of the raw well reads into an sfffile without any filtering...
Forum: 454 Pyrosequencing 10-31-2011, 10:26 AM
Replies: 1
Views: 775
Posted By proteasome
We use both Lonza Flash Gels and the Bioanalyzer....

We use both Lonza Flash Gels and the Bioanalyzer. For established assays we can usually get away with just using a flash gel, however if you're doing shotgun sequencing the bioanalyzer is important...
Forum: 454 Pyrosequencing 08-30-2011, 09:45 AM
Replies: 4
Views: 1,243
Posted By proteasome
I second the idea of reprocessing with a...

I second the idea of reprocessing with a non-amplicon pipeline and turning many of the quality filters off. We have successfully uncovered problems (such as incompatibilities between our amplicon and...
Forum: 454 Pyrosequencing 08-29-2011, 09:57 AM
Replies: 4
Views: 1,243
Posted By proteasome
We have not been able to figure out what the...

We have not been able to figure out what the problem is yet. For us, bad runs seem to come in batches so we figured it was a problem with one of our lots.

Some things to consider, based on our...
Forum: 454 Pyrosequencing 08-15-2011, 07:46 AM
Replies: 9
Views: 1,612
Posted By proteasome
I've done 454 FLX and Jr sequencing on 1,000 bp...

I've done 454 FLX and Jr sequencing on 1,000 bp amplicons without modifying the protocol at all and not had problems. Have you checked that there's not some other problem going on with your template...
Forum: 454 Pyrosequencing 08-11-2011, 08:11 AM
Replies: 4
Views: 1,243
Posted By proteasome
Anyone else having Lib-A GS Jr problems recently?

Recently we've been having problems related to the quality of our Lib-A sequencing on the Jr. Very few passed filter reads, mixed-like flowgrams when our enrichment is correct, or problems with the...
Forum: Bioinformatics 05-25-2011, 01:19 PM
Replies: 26
Views: 2,865
Posted By proteasome
If you're generally looking to cleanup 454 data I...

If you're generally looking to cleanup 454 data I would suggest using Galaxy http://main.g2.bx.psu.edu/to convert your sff files to fastq, and then using fastq filters and tools to remove short reads...
Forum: Bioinformatics 02-22-2011, 08:10 AM
Replies: 2
Views: 998
Posted By proteasome
I found the section. Thanks!

I found the section. Thanks!
Forum: Bioinformatics 02-21-2011, 12:49 PM
Replies: 2
Views: 998
Posted By proteasome
Recovering all keypass 454 reads

I've done several Lib-A experiments where a significant percentage of my "A" reads are getting lost somewhere.

I know I have amplified template, since I get the corresponding "B" reads that...
Forum: 454 Pyrosequencing 08-01-2010, 10:04 AM
Replies: 21
Views: 6,738
Posted By proteasome
Debabrata: For current "Titanium" reagents...

Debabrata:

For current "Titanium" reagents the adapter sequences are:

A: CGTATCGCCTCCCTCGCGCCATCAG
B: CTATGCGCCTTGCCAGCCCGCTCAG


Simon
Forum: Bioinformatics 11-12-2009, 10:04 AM
Replies: 3
Views: 3,425
Posted By proteasome
We do highly multiplexed amplicon-based...

We do highly multiplexed amplicon-based genotyping with 454 and have found AVA inadequate.

Here's how we deconvolute and analyze the tagged sequence data. The key is to split apart the .sff files...
Showing results 1 to 21 of 21

 


All times are GMT -8. The time now is 03:02 AM.


Powered by vBulletin® Version 3.8.6
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.