SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 19 of 19
Search took 0.00 seconds.
Search: Posts Made By: Tom2013
Forum: Illumina/Solexa 03-26-2020, 08:13 AM
Replies: 5
Views: 1,837
Posted By Tom2013
Thanks for your reply. Option 2 worked well.

Thanks for your reply. Option 2 worked well.
Forum: Illumina/Solexa 02-04-2020, 10:44 AM
Replies: 5
Views: 1,837
Posted By Tom2013
No, I am not uploading to BaseSpace. I know...

No, I am not uploading to BaseSpace. I know re-analyzing data after Miseq run is complicated, as read1 and read2 do not contain barcode sequences.

I wonder whether correcting that index sequence...
Forum: Illumina/Solexa 02-03-2020, 04:14 PM
Replies: 5
Views: 1,837
Posted By Tom2013
Change standard index sequence in sample sheet for Miseq

We synthesized fusion primers (i.e p7(or p5)-index-Transposase- gene_specific_Primer) using the Nextera adapter and index sequences, and prepared a library for Miseq. When I prepared the sample sheet...
Forum: Illumina/Solexa 12-02-2019, 11:47 AM
Replies: 3
Views: 1,236
Posted By Tom2013
Thumbs up You are right!

You are right!
Forum: Illumina/Solexa 11-26-2019, 11:16 AM
Replies: 3
Views: 1,236
Posted By Tom2013
Thanks a lot for your reply. Are there any...

Thanks a lot for your reply.
Are there any document/post(s) mention that "the sequencing primer binding site is actually contained within the Nextera transposase sequence"?
Forum: Illumina/Solexa 11-26-2019, 09:43 AM
Replies: 3
Views: 1,236
Posted By Tom2013
Can I use default sequencing primers for Miseq?

I use below PCR primers to prepare libraries for Miseq amplicon sequencing:

i7-INDEX2-Spacer- gene_specific_Primer

CAAGCAGAAGACGGCATACGAGAT TCGCCTTA GTCTCGTGGGCTCGG +gene_specific_Primer
...
Forum: Bioinformatics 10-21-2015, 06:33 AM
Replies: 5
Views: 1,152
Posted By Tom2013
I used blast2go for mapping and annotation. The...

I used blast2go for mapping and annotation. The B2G pro is very fast for GO term mapping and it is very easy to use.
Forum: Bioinformatics 10-21-2015, 05:54 AM
Replies: 5
Views: 1,152
Posted By Tom2013
Thanks for your replies. I have done annotation.

Thanks for your replies. I have done annotation.
Forum: Bioinformatics 10-13-2015, 06:47 AM
Replies: 5
Views: 1,152
Posted By Tom2013
gene annotation for a large number of genes

Hello,

I have around 60 000 genes from RNA-seq data. I have blasted each sequence to the nr database and obtained a xml file. Does anybody know what softwares can be used for down stream GO term...
Forum: RNA Sequencing 10-08-2015, 10:20 AM
Replies: 1
Views: 1,242
Posted By Tom2013
GO enrichment analysis for RNA-Seq data

I aim to compare transcriptomic response in a non-model species using RNA-Seq. So far, I have applied local blastx to analyzed all the expressed genes (around 60 000 genes) and obtained the xml file....
Forum: Bioinformatics 09-14-2015, 07:08 AM
Replies: 92
Views: 40,265
Posted By Tom2013
Hi bigmw, I am working on non-model species....

Hi bigmw,

I am working on non-model species. I have done differentially expressed gene analysis (gene level) using DESeq2 and used blastx to blast all expressed genes to the nr database. I am...
Forum: Sample Prep / Library Generation 09-07-2015, 11:12 AM
Replies: 6
Views: 8,105
Posted By Tom2013
I used the wrong assay. It was set to...

I used the wrong assay.
It was set to prokaryote total RNA assay. I did not change the assay to eukaryote total RNA assay when checked quality for fish RNA.
Does anybody know how to re=analyze the...
Forum: Bioinformatics 07-03-2015, 07:58 AM
Replies: 4
Views: 1,499
Posted By Tom2013
Smile After installed the latest R, I can install the...

After installed the latest R, I can install the latest DESeq2. The code works now.
Thank you very much for your help.
Forum: Bioinformatics 07-02-2015, 12:19 PM
Replies: 4
Views: 1,499
Posted By Tom2013
Thank you for your answer. >...

Thank you for your answer.

> packageVersion("DESeq2")
[1] 1.4.5

It's 1.4.5, although I re-installed DESeq2 from Bioconductor yesterday.
Forum: Bioinformatics 07-02-2015, 07:54 AM
Replies: 4
Views: 1,499
Posted By Tom2013
pca in DESeq2

Hello,

I run successfuly using the following code in DESeq2:
plotPCA(rld, intgroup=c("population", "treatment"))

However, I would like to use ggplot2 to draw a nice PCA plot as showed in the ...
Forum: Bioinformatics 03-20-2015, 08:58 AM
Replies: 1
Views: 1,761
Posted By Tom2013
DESeq2- How to get all levels of the interaction term

Dear All,

I have two populations (L and S) and two treatments (C and S). I would like to compare gene expression for each treatment in each population.
The SampleTable is as follows:...
Forum: Bioinformatics 05-08-2014, 09:48 AM
Replies: 3
Views: 1,385
Posted By Tom2013
Does anybody have experience in running 70GB data...

Does anybody have experience in running 70GB data in a computer with 32GB ram?
Forum: Bioinformatics 04-25-2014, 08:53 AM
Replies: 3
Views: 1,385
Posted By Tom2013
Before I run all the sequences, I run only 1...

Before I run all the sequences, I run only 1 sample (1 left file, 1 right file, 6.6GB in total) and it worked.
Forum: Bioinformatics 04-25-2014, 08:50 AM
Replies: 3
Views: 1,385
Posted By Tom2013
trinity runing error

Hi everyone,

The RAM of my computer is 32GB and the size of my data is about 66GB. I set --JM 20G, --CPU. the Chrysalis process failed:

-------------------
---- Chrysalis ----...
Showing results 1 to 19 of 19

 


All times are GMT -8. The time now is 12:35 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO