SEQanswers

Go Back   SEQanswers > Search Forums

Showing results 1 to 3 of 3
Search took 0.00 seconds.
Search: Posts Made By: annguyen
Forum: Bioinformatics 01-14-2021, 11:07 AM
Replies: 0
Views: 1,090
Posted By annguyen
High gap penalty in BWA

I'm using BWA MEM to align paired-end fastq files to two reference sequences (50bp and 80bp):

>ref1
TCGTAACGCAAGTTGGATACTCTCGA******************************GGATGTTGCCGTCCTCCTTGAAGT

>ref2...
Forum: Bioinformatics 01-14-2021, 06:19 AM
Replies: 1
Views: 2,870
Posted By annguyen
I think those are default penalty weights: ...

I think those are default penalty weights:

Gap open: cost to make gaps
Gap extension: cost to make gaps bigger
Forum: UK - Cambridge 11-10-2020, 01:42 PM
Replies: 1
Views: 17,961
Posted By annguyen
Sequencing analysis

Hi everyone,

Can anyone let me know how to compute the percentage of correct sequences for demultiplexed samples and sum of reads that 100% align both match and del reference sequences spanning...
Showing results 1 to 3 of 3

 

All times are GMT -8. The time now is 07:48 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2022, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO