SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read


Page 1 of 2 1 2
Showing results 1 to 25 of 41
Search took 0.00 seconds. Search: Posts Made By: ebioman
Forum: Bioinformatics 04-29-2015, 04:45 AM
Replies: 2
Views: 3,438
Posted By ebioman
Help solve problems for the next ones

Hello tinguzman
Since you figured out by yourself how to fix the first problem would you mind sharing
your solution ? I just encountered the same issue and was a little bit disappointing that
you...
Forum: RNA Sequencing 03-13-2015, 01:37 AM
Replies: 2
Views: 4,211
Posted By ebioman
Thanks fanli It is indeed really strange and I...

Thanks fanli
It is indeed really strange and I could not find any explanation nowhere.
At the moment I really hesitate to use these categories if there is a potential of such high FDR values,,,,
Forum: RNA Sequencing 03-12-2015, 04:48 AM
Replies: 2
Views: 4,211
Posted By ebioman
GO analysis with DAVID and FDR confusion

Hello
I recently got a big RNAseq analysis to do downstream analysis and comparison with other
published experiments. The group analyzed the data with the online tool DAVID for gene ontologies and...
Forum: Bioinformatics 01-20-2015, 08:37 AM
Replies: 6
Views: 5,709
Posted By ebioman
Hi But does it essentially add the sequence to...

Hi
But does it essentially add the sequence to the database and (real warning) ,
or does it skip this sequence (error)? It isnt really conclusive to me :confused:
Forum: Bioinformatics 01-20-2015, 08:32 AM
Replies: 4
Views: 8,193
Posted By ebioman
Smile Thanks, that was helpful! Indeed I find...

Thanks, that was helpful!
Indeed I find sometimes the contrast list somehow confusing (syntax wise).
Why would be

test for an interaction of tissue and genotype specific for the treatment...
Forum: Bioinformatics 01-14-2015, 02:17 AM
Replies: 4
Views: 8,193
Posted By ebioman
DESEQ2 multiple factors + interaction analysis

Hello
First, I want to emphasize that reading his forum was already really extremely helpful
overcoming some of the issues I had initially grasping the concept of designs in Deseq2.
Nevertheless I...
Forum: Pacific Biosciences 10-07-2014, 02:33 AM
Replies: 12
Views: 6,344
Posted By ebioman
Another good (and quick) check can be the...

Another good (and quick) check can be the coverage.
Just re-map all your reads onto the obtained genome and look at the coverage (should be already in your final results as well).
If you look at...
Forum: Bioinformatics 08-08-2014, 01:00 AM
Replies: 1
Views: 3,768
Posted By ebioman
A one liner for a simple genome

This is pretty old but the problem might still persist.

I took the final result file with the structure:


GLIMMER (ver. 3.02; iterated) predictions:
orfID start end frame score...
Forum: Bioinformatics 08-06-2014, 04:10 AM
Replies: 1
Views: 2,544
Posted By ebioman
Hello These stem from the database which (I...

Hello
These stem from the database which (I guess) is in your case provided by SnpEff.
If I recall correctly SNPeff updates from time to time their database based on ENSEMBL. Now it all depends how...
Forum: Bioinformatics 07-30-2014, 07:46 AM
Replies: 22
Views: 19,768
Posted By ebioman
Exclamation So most scripts here actually take the scaffold...

So most scripts here actually take the scaffold length at which the sum is bigger than half the genome size. But should it not be equal AND/OR bigger ?


from the Assemblathon paper
Forum: Bioinformatics 07-10-2014, 05:56 AM
Replies: 2
Views: 2,605
Posted By ebioman
Hi It looks to me as if your java version is...

Hi
It looks to me as if your java version is old - I had the same issue and updating it fixed it.
Cheers
Forum: Bioinformatics 02-26-2014, 07:04 AM
Replies: 4
Views: 3,418
Posted By ebioman
Hi Having the same issue - but I guess you...

Hi
Having the same issue - but I guess you never figured it out ? :(
Forum: Bioinformatics 01-15-2014, 05:28 AM
Replies: 0
Views: 1,208
Posted By ebioman
Sequin converter

Hello

I annotated a chloroplastic genome with a tool producing either a "sequin" or a "genvision" annotation. I understand that sequin might be very handy for submission later. At the moment I...
Forum: Pacific Biosciences 12-17-2013, 07:24 AM
Replies: 20
Views: 10,496
Posted By ebioman
Thumbs up @rhall You are a life-saver ! :D Such a...

@rhall
You are a life-saver ! :D
Such a stupid and obvious mistake and I am looking into this problem for a week now !
Now everything works like charm - it was this particular identifier which is...
Forum: Pacific Biosciences 12-17-2013, 04:48 AM
Replies: 20
Views: 10,496
Posted By ebioman
I did now another test with the minimal example...

I did now another test with the minimal example from the Whitelist-tutorial and my data in parallel - still the same outcome, failing of filtering :mad:


So, what I did was to filter the example...
Forum: Pacific Biosciences 12-17-2013, 12:24 AM
Replies: 20
Views: 10,496
Posted By ebioman
It looks okay on the first glance: # Task...

It looks okay on the first glance:


# Task filter_001of001 commands:
filterPlsH5.py --filter='MinReadScore=0.80,MinSRL=500,MinRL=500,ReadWhitelist=whitelist.txt' --trim='True'...
Forum: Bioinformatics 12-13-2013, 02:39 AM
Replies: 7
Views: 3,775
Posted By ebioman
Since you removed almost half of them might it be...

Since you removed almost half of them might it be possible that you remove only one direction ?

From the Manual:



I would just use a small fraction of your reads and test it otherwise with...
Forum: Bioinformatics 12-13-2013, 02:25 AM
Replies: 7
Views: 3,775
Posted By ebioman
Hi We have an internal file with many adapter,...

Hi
We have an internal file with many adapter, with the following format:


>[Oligonucleotide sequences for Genomic DNA 1]
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
>[Oligonucleotide sequences for...
Forum: Pacific Biosciences 12-13-2013, 12:47 AM
Replies: 20
Views: 10,496
Posted By ebioman
I think I get slowly closer to the underlying...

I think I get slowly closer to the underlying problem rhall.
I checked for the particular smartcell how many ZMWs were present:


h5ls -r...
Forum: Pacific Biosciences 12-12-2013, 08:25 AM
Replies: 20
Views: 10,496
Posted By ebioman
Thumbs up Thanks for clearing a little bit the fog I...

Thanks for clearing a little bit the fog

I went through the list and found a few reads which hat 0,0,0 but most of them were either
1,1,0 or 1,2,0 (similar for the ones in my example). What...
Forum: Pacific Biosciences 12-12-2013, 12:58 AM
Replies: 20
Views: 10,496
Posted By ebioman
Unhappy Hello rhall Indeed I did not realize before...

Hello rhall
Indeed I did not realize before that the filtered_subreads.fasta file was empty.

It is strange I broke down everything to a more minimal style

<?xml version="1.0"?>...
Forum: Pacific Biosciences 12-11-2013, 06:36 AM
Replies: 20
Views: 10,496
Posted By ebioman
Thanks a lot boetsie Indeed your whitelist...

Thanks a lot boetsie
Indeed your whitelist looks very similar, as does the config and start-command.

I tried your config file which worked, but stopped at the same position and gave me again an...
Forum: Pacific Biosciences 12-11-2013, 06:03 AM
Replies: 20
Views: 10,496
Posted By ebioman
Hi GenoMax Thanks for the reply. Yes, since I...

Hi GenoMax
Thanks for the reply.
Yes, since I am running as a local user (eschmid) the pipeline - not in the smartportal but terminal mode. It is actually the current working directory in which I...
Forum: Pacific Biosciences 12-11-2013, 05:35 AM
Replies: 20
Views: 10,496
Posted By ebioman
Unhappy Hi I would like to tie in with part of the...

Hi I would like to tie in with part of the question.
Similarly like you, I discovered that HGAP2 would not take filtered sequences :mad:

One might wonder about the use of such a scenario. But...
Forum: Bioinformatics 11-28-2013, 12:08 AM
Replies: 6
Views: 2,373
Posted By ebioman
@flxlex you will laugh now, but that is what I am...

@flxlex you will laugh now, but that is what I am actually dealing with.

I am only facing the problem that I got so far only the ALLORA module running for the chloroplast. I have an entire genome...
Showing results 1 to 25 of 41
Page 1 of 2 1 2

 


All times are GMT -8. The time now is 02:56 AM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO