SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 121
Search took 0.01 seconds.
Search: Posts Made By: cmbetts
Forum: Bioinformatics 03-15-2021, 02:19 PM
Replies: 1
Views: 3,292
Posted By cmbetts
So that's why my bam files look like garbled...

So that's why my bam files look like garbled nonsense when I open them in a text editor. They are in Latin! If only I'd been more cultured my research could have gone much faster if I could read...
Forum: General 02-24-2021, 12:39 PM
Replies: 3
Views: 2,567
Posted By cmbetts
Takara Bio distributes Macherey Nagel products. ...

Takara Bio distributes Macherey Nagel products. They tend to have products that are 1 for 1 replacements for Qiagen cleanup kits.
Forum: Bioinformatics 01-25-2021, 02:17 PM
Replies: 4
Views: 1,459
Posted By cmbetts
It's treating each of your fastq files as an...

It's treating each of your fastq files as an independent sample, and making a sam file for each, which is what most people generally want to do. If you don't care about keeping them separate, you...
Forum: RNA Sequencing 09-16-2020, 02:55 PM
Replies: 6
Views: 4,166
Posted By cmbetts
You might try to look at some of the method/kit...

You might try to look at some of the method/kit comparison papers, or a paper describing a new library prep method. They often compare inter and intra assay performance of replicate inputs, usually...
Forum: Illumina/Solexa 09-03-2020, 10:11 AM
Replies: 8
Views: 4,248
Posted By cmbetts
You implied that you used a specific library prep...

You implied that you used a specific library prep kit and are following manufacturer's recommendations. Can you share which kit so we could better understand potential library structure issues?
Forum: Sample Prep / Library Generation 08-24-2020, 10:42 AM
Replies: 289
Views: 171,424
Posted By cmbetts
The random tagmentation (or sonication/ligation)...

The random tagmentation (or sonication/ligation) will give it plenty of diversity. Lower diversity library types needing extra PhiX are things like amplicons, microbiome 16S, and WGBS.
Forum: Sample Prep / Library Generation 08-14-2020, 10:32 AM
Replies: 1
Views: 1,956
Posted By cmbetts
You'd likely run into some nasty color balance...

You'd likely run into some nasty color balance issues just trying to add on an external adapter, and who knows what would happen during clustering with internal P5/P7.

Then you're especially stuck...
Forum: De novo discovery 06-04-2020, 04:12 PM
Replies: 2
Views: 4,705
Posted By cmbetts
Could you explain a little more about you're...

Could you explain a little more about you're intending to accomplish? As I understand it, you're performing paired end sequencing on a MiSeq. You then take the spent flowcell, and perform the...
Forum: Illumina/Solexa 03-26-2020, 11:58 AM
Replies: 2
Views: 3,179
Posted By cmbetts
It depends on your amplicon length and what...

It depends on your amplicon length and what you're trying to learn about it.

If it's shorter than ~500bp, you can amplify it directly with PCR primers with flanking Illumina adapter sequences, but...
Forum: RNA Sequencing 12-02-2019, 11:13 AM
Replies: 6
Views: 7,642
Posted By cmbetts
Color by first strand in pair and pick a...

Color by first strand in pair and pick a housekeeping gene (actin, GAPDH, etc). If you see roughly equal color mix, nondirectional. Nearly all the same color, directional with the protocol...
Forum: RNA Sequencing 11-21-2019, 09:36 AM
Replies: 4
Views: 4,428
Posted By cmbetts
Whoops. Same conclusion though. Gs are still...

Whoops. Same conclusion though. Gs are still the dark channel in the iSeq chemistry
Forum: RNA Sequencing 11-20-2019, 03:29 PM
Replies: 4
Views: 4,428
Posted By cmbetts
I take it these are NextSeq or NovaSeq? This...

I take it these are NextSeq or NovaSeq?

This is an adapter dimer that's read through the p7 sequence (ATCTCGTATGCCGTCTTCTGCTTG) into the FC and started spitting out Gs because no template = no...
Forum: Sample Prep / Library Generation 10-08-2019, 03:47 PM
Replies: 3
Views: 1,638
Posted By cmbetts
By bad annotation, I mean that the...

By bad annotation, I mean that the polyadenylation sites in RefSeq/Gencode are often incorrect, which can make it difficult to amplify the 3'UTR (Refseq in particular tends to choose the longest 3'...
Forum: Sample Prep / Library Generation 10-07-2019, 04:33 PM
Replies: 3
Views: 1,638
Posted By cmbetts
1. Sure, you can swap in different length RT...

1. Sure, you can swap in different length RT primers without a noticeable impact on performance
2. SSII is definitely better than SSIII, but I don't know about IV
3. I personally like Takara's...
Forum: General 10-01-2019, 01:57 PM
Replies: 6
Views: 3,864
Posted By cmbetts
Again, it's highly dependent on your situation. ...

Again, it's highly dependent on your situation.

You'll need to either buy a ssDNA library kit (usually a minimum 12rxn size) or put something homebrew together based on a published protocol. which...
Forum: General 09-30-2019, 12:48 PM
Replies: 6
Views: 3,864
Posted By cmbetts
Yes, but with levels of difficulty ranging from...

Yes, but with levels of difficulty ranging from trivial to very difficult. If they're for an NGS related application, there's a good chance they're just common primers you can pick from a catalogue...
Forum: Ion Torrent 08-02-2019, 09:22 AM
Replies: 19
Views: 13,053
Posted By cmbetts
Is there a reason you need your own sequencer? ...

Is there a reason you need your own sequencer? You're highly unlikely to ever break even vs making homebrew Illumina libraries and sending them to a service facility that will pool them onto a...
Forum: Sample Prep / Library Generation 05-22-2019, 10:19 AM
Replies: 2
Views: 2,096
Posted By cmbetts
The FA/BA is probably a more accurate measurement...

The FA/BA is probably a more accurate measurement (although I trust qubit more for concentrations >1ng/ul). It's easy to get background readings of 0.1-0.3ng/ul by qubit. Did you run a negative...
Forum: General 05-14-2019, 05:05 PM
Replies: 1
Views: 2,938
Posted By cmbetts
Well that sure cleared up how to translate from...

Well that sure cleared up how to translate from one programming language from another...

Your PI probably wants it in Perl because they can read/write Perl, but not Python and want to double check...
Forum: Sample Prep / Library Generation 04-05-2019, 02:41 PM
Replies: 3
Views: 1,064
Posted By cmbetts
Take a page out of old school RACE (or...

Take a page out of old school RACE (or Tang/Quartz scRNA-Seq for a more modern example). Add a homopolymer tail using TdT, perform second strand with a complementary primer also with a defined tag,...
Forum: Sample Prep / Library Generation 04-05-2019, 02:21 PM
Replies: 10
Views: 2,689
Posted By cmbetts
Template switching definitely doesn't need a 5'...

Template switching definitely doesn't need a 5' cap to work. Clontech's (Takara) SMARTer stranded kits all use template switching on chemically fragmented RNA with random priming. The internal...
Forum: Bioinformatics 04-01-2019, 12:22 PM
Replies: 7
Views: 1,585
Posted By cmbetts
That sequence isn't derived from the fragment...

That sequence isn't derived from the fragment you're trying to sequence. 100% of it was chemically synthesized by your oligo synthesis company. It match close enough to your insert of interest to...
Forum: Sample Prep / Library Generation 03-01-2019, 10:31 AM
Replies: 10
Views: 2,689
Posted By cmbetts
I'd start with as SMARTseq2 like protocol as fits...

I'd start with as SMARTseq2 like protocol as fits with your design and optimize from there.
I can't go too much in the black magic parts (former Clontech/Takara employee, and still friendly with...
Forum: Sample Prep / Library Generation 03-01-2019, 10:10 AM
Replies: 10
Views: 2,689
Posted By cmbetts
Are you using default SSII buffer? MgCl2 levels...

Are you using default SSII buffer? MgCl2 levels are very important for TS, and higher than most standard buffers.
Forum: RNA Sequencing 02-28-2019, 05:51 PM
Replies: 2
Views: 2,943
Posted By cmbetts
I'd be careful about using them for Prokaryotes. ...

I'd be careful about using them for Prokaryotes. Many of them are actually bacterial genes, mostly B.subtilis if I remember correctly, but also some antibiotic resistance genes descended from Affy...
Showing results 1 to 25 of 121

 


All times are GMT -8. The time now is 11:21 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO