
Go Back   SEQanswers > Search Forums

Showing results 1 to 25 of 39
Search took 0.02 seconds.
Search: Posts Made By: raela
Forum: Bioinformatics 07-03-2011, 08:24 PM
Replies: 10
Views: 5,321
Posted By raela
No, what I said is correct - you are thinking of...

No, what I said is correct - you are thinking of "bwa bwasw" as an alternate to aln + samse/sampe. The -a bwtsw uses the algorithm for indexing a large genome. BWTSW vs. IS has nothing to do with...
Forum: Bioinformatics 08-13-2010, 09:15 AM
Replies: 3
Views: 2,501
Posted By raela
Actually, the 'tophat' command itself is a python...

Actually, the 'tophat' command itself is a python script that could potentially be edited if you wanted to hack at that. Save a copy first in case a change makes it stop working.
Forum: Bioinformatics 08-10-2010, 04:49 AM
Replies: 6
Views: 6,134
Posted By raela
I've had sampe hang before when the pairs were...

I've had sampe hang before when the pairs were not lined up correctly in the two files. Since splitting fixes your issue, this is probably not what's going on, but it doesn't hurt to check.
Forum: Literature Watch 08-06-2010, 06:54 AM
Replies: 11
Views: 4,964
Posted By raela
I don't know if this is relevant, but do you...

I don't know if this is relevant, but do you already have a built bowtie index?
Bowtieidx = /home/bogugk/XXX/MapSplice_1.13.6/bin/bowtie-build/
^ they want the path to the index, not to...
Forum: Bioinformatics 08-05-2010, 07:59 AM
Replies: 35
Views: 18,687
Posted By raela
You would use dog, not dog.fa. It adds the .fa...

You would use dog, not dog.fa. It adds the .fa for you when it
Forum: General 08-05-2010, 07:56 AM
Replies: 12
Views: 3,093
Posted By raela
My scores went from something like ...

My scores went from something like
Forum: General 08-05-2010, 04:41 AM
Replies: 12
Views: 3,093
Posted By raela
MAQ will actually do this for you - look into maq...

MAQ will actually do this for you - look into maq sol2sanger. I believe it's just `maq sol2sanger old.fastq new.fq` (or something like that) - it's how I've converted the reads I use. Also, for nice...
Forum: Bioinformatics 08-04-2010, 11:08 AM
Replies: 2
Views: 2,114
Posted By raela
Yes, download all of the FASTA chromosome...

Yes, download all of the FASTA chromosome sequences from your source of choice.

Choose one of the mm#, go to bigZips/, and get the chromFa.tar.gz
Forum: Bioinformatics 07-28-2010, 07:34 AM
Replies: 10
Views: 2,197
Posted By raela
How long do you mean by 'very large'? It depends...

How long do you mean by 'very large'? It depends on the sequencing technology used and the length ordered. Even 200 is somewhat in the 'long' range for NGS (I believe).
Forum: Bioinformatics 07-26-2010, 09:45 AM
Replies: 147
Views: 56,540
Posted By raela
I must be missing something.. it isn't producing...

I must be missing something.. it isn't producing any output for me, but it also isn't giving an error. I'm trying to convert my BAM file to the pindel format:

[heather@frankie (Mon Jul 26...
Forum: Bioinformatics 07-26-2010, 04:47 AM
Replies: 16
Views: 10,656
Posted By raela
Not sure if it'll work in your case, but try...

Not sure if it'll work in your case, but try running it as:
cat 1M_1.txt | fastx_clipper -a AAGCAGTGGTATCAACGCAGAGTACGCGGG -M 20 -n > output.txt
Forum: Bioinformatics 07-23-2010, 09:15 AM
Replies: 16
Views: 10,656
Posted By raela
With some of the tools in fastx_toolkit, I've...

With some of the tools in fastx_toolkit, I've found redirection and flags act differently. Most give the option of using -i infile -o outfile or `cat inline | tool > outfile` - if you're using -i -o,...
Forum: Bioinformatics 07-13-2010, 10:19 AM
Replies: 10
Views: 5,321
Posted By raela
That would most likely be the issue! You need to...

That would most likely be the issue! You need to combine the chromosomes into one file. On a *nix machine, say each is named chr##.fa (I know it's this way for the horse.. chr1, chr2, chr3, ... chrX)...
Forum: Bioinformatics 07-13-2010, 08:33 AM
Replies: 10
Views: 5,321
Posted By raela
Also, if you did index it, are you sure you...

Also, if you did index it, are you sure you indexed correctly? I had the same issue until I made another index for the genome, then it ran fine. If you want to test if it's the reads, only grab one...
Forum: Bioinformatics 07-09-2010, 11:57 AM
Replies: 4
Views: 4,895
Posted By raela
Ah yes, didn't think about that, either.. I'm in...

Ah yes, didn't think about that, either.. I'm in the same boat, I've been hosting on my own network. One thing that helps me is filtering out unmatched reads, even if only for viewing on UCSC. I...
Forum: Bioinformatics 07-09-2010, 11:08 AM
Replies: 4
Views: 4,895
Posted By raela
I would double check the file is there and okay....

I would double check the file is there and okay. Have you gone to the location in your browser window and seen if it asks you to download the file? If so, you should be good. I usually see that when...
Forum: Bioinformatics 07-01-2010, 06:09 AM
Replies: 6
Views: 4,432
Posted By raela
I had BWA segmentation fault issues with bwa aln....

I had BWA segmentation fault issues with bwa aln. It turned out my reference fasta file was somehow damaged (I used cat to combine the equine chromosome files into one). Once I received a working...
Forum: Bioinformatics 06-30-2010, 06:34 PM
Replies: 12
Views: 2,880
Posted By raela
Well, I just ran the script with that genome with...

Well, I just ran the script with that genome with no issues, so I really don't know, sorry. Last advice I can give is make sure it's compiled as a 64 bit binary, in case ubuntu has multilib. Use...
Forum: Bioinformatics 06-30-2010, 12:54 PM
Replies: 12
Views: 2,880
Posted By raela
Could you provide a link to the bacterial genome...

Could you provide a link to the bacterial genome you used? I'll try on the computer I have.
Forum: Bioinformatics 06-29-2010, 08:19 AM
Replies: 12
Views: 2,880
Posted By raela
That step doesn't look like it produces much data...

That step doesn't look like it produces much data to me, but perhaps it's everything it takes in to run it. 32bit can cause buffer overflow issues - do you have access to a 64 bit machine? The 32 bit...
Forum: Bioinformatics 06-29-2010, 06:02 AM
Replies: 12
Views: 2,880
Posted By raela
Are you running 32 bit or 64 bit? If 32 bit, it...

Are you running 32 bit or 64 bit? If 32 bit, it might be an issue there. Also, did you just run demo, or did you follow the instructions and download a genome and maq-data then do ` demo...
Forum: Bioinformatics 06-21-2010, 07:29 AM
Replies: 13
Views: 5,420
Posted By raela
I believe the problem is the older version.. I...

I believe the problem is the older version.. I think I had similar issues when I tried using that one. Instead try to install this one:
Forum: Bioinformatics 06-03-2010, 11:26 AM
Replies: 5
Views: 8,446
Posted By raela
I would try another script to convert your files....

I would try another script to convert your files. I haven't done anything with solid myself, so I don't have any advice there, but the reads you posted didn't convert very well. There should be a...
Forum: Bioinformatics 06-02-2010, 01:20 PM
Replies: 18
Views: 7,467
Posted By raela
It would be more helpful if you could produce the...

It would be more helpful if you could produce the full results of 'make'. You can use code tags to keep the paste to a reasonable size. Try make results here.
Forum: Bioinformatics 06-02-2010, 01:15 PM
Replies: 18
Views: 8,224
Posted By raela
The second code block of my previous post has the...

The second code block of my previous post has the contents of all of the files in logs/ from that run. It produced filewFaQvp.log, long_spanning_reads.log, prep_reads.log, run.log. The bowtie error...
Showing results 1 to 25 of 39


All times are GMT -8. The time now is 06:58 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO