SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 64
Search took 0.01 seconds.
Search: Posts Made By: gfmgfm
Forum: Bioinformatics 07-26-2014, 09:42 PM
Replies: 3
Views: 1,717
Posted By gfmgfm
Thanks a lot for the answer. This is indeed...

Thanks a lot for the answer.

This is indeed because of empty junction.
The way to overcome this error is by adding --no-novel-juncs
Forum: Bioinformatics 07-22-2014, 09:00 PM
Replies: 3
Views: 1,717
Posted By gfmgfm
Hello, We get the same error with aligning...

Hello,

We get the same error with aligning RNA seq spikes with tophat2.
Did you find the problem?

Thanks
Forum: RNA Sequencing 12-30-2013, 01:08 AM
Replies: 17
Views: 13,915
Posted By gfmgfm
Thanks a lot!

Thanks a lot!
Forum: RNA Sequencing 12-29-2013, 11:24 PM
Replies: 17
Views: 13,915
Posted By gfmgfm
Hello all, Anyone has an idea how to count...

Hello all,

Anyone has an idea how to count in tophat2 bam file the uniquely mapped reads?
Tophat(1) had mapping quality of 255 for uniquely mapping. Tophat2 has changed that, and I don't manage...
Forum: Bioinformatics 08-31-2013, 10:01 PM
Replies: 9
Views: 4,305
Posted By gfmgfm
Current Illumina's qualities in the fastq files...

Current Illumina's qualities in the fastq files changed since the first post on this issue. They are now (Illumina 1.8+) Phred+33, and therefore no need to specify -I for BWA. Just make sure the...
Forum: Bioinformatics 08-25-2013, 09:12 PM
Replies: 4
Views: 2,315
Posted By gfmgfm
Thank you. This is very helpful!

Thank you. This is very helpful!
Forum: Bioinformatics 08-25-2013, 09:58 AM
Replies: 4
Views: 2,315
Posted By gfmgfm
CPM after batch effect correction in edgeR

Hello,

I wonder if you figured out how to print CPM after batch effect correction. I am trying to do exactly the same.

Many thanks.
Forum: Bioinformatics 07-09-2013, 02:11 AM
Replies: 2
Views: 747
Posted By gfmgfm
Thanks a lot for the reply. Yes I meant using...

Thanks a lot for the reply.
Yes I meant using the SizeFactors only for normalization due to different coverage between the samples.
I know one must have replicate - but still don't have them all :)
Forum: Bioinformatics 07-08-2013, 09:54 PM
Replies: 2
Views: 747
Posted By gfmgfm
DESeq without replicates

Hello all,

Does DESeq use replicate info in estimateSizeFactors?

For RNA seq without replicates - will it be OK to normalize the data using:
estimateSizeFactors
(and then dividing each column...
Forum: Bioinformatics 11-15-2012, 10:00 PM
Replies: 0
Views: 740
Posted By gfmgfm
small RNA seq coverage

Hi all,

Anyone has recommendation for the coverage that is needed when sequencing small RNA seq, for micro RNAs in human/mouse, using Illumina?

Thanks.
Forum: Bioinformatics 07-16-2012, 05:24 AM
Replies: 0
Views: 970
Posted By gfmgfm
cutadapt problem

Hi all,

I have the following problem with cutadapt: I ask to remove an adapter only once, but it removes it more than once.

The read:
TTCCACTTGAGTCCAGGGTGCGTACGCTGCAGGTCGACTCCAC

The...
Forum: Bioinformatics 06-12-2012, 05:37 AM
Replies: 0
Views: 941
Posted By gfmgfm
whole genome sequencing of mouse genome

Hi all,

Does anybody know what is the number of reads (and what coverage per base) which are needed for sequencing of mouse whole genome - in order to detect translocations, using Illumina...
Forum: Bioinformatics 02-22-2012, 10:19 PM
Replies: 12
Views: 3,132
Posted By gfmgfm
Hi LizBent, I guess this depends on the...

Hi LizBent,

I guess this depends on the overlap between the 2 genomes you are analyzing If there are very similar genes, I guess they might cluster together.
Forum: Bioinformatics 02-18-2012, 09:50 PM
Replies: 3
Views: 2,147
Posted By gfmgfm
TopHat and cufflinks of non-strand-specific reads

Hi all,

I have questions regarding the strand info after TopHat and Cufflinks in NON-strand-specific experiments. I tried to look for the answers in the forum and in the web but did not manage,...
Forum: Bioinformatics 10-02-2011, 03:09 AM
Replies: 9
Views: 3,874
Posted By gfmgfm
Still didn't resolve the problem...

Still didn't resolve the problem...
Forum: Bioinformatics 09-28-2011, 01:50 AM
Replies: 9
Views: 3,874
Posted By gfmgfm
Thanks for the reply. I am not sure if Partek...

Thanks for the reply.
I am not sure if Partek does filtering - they say very little in their white pages.
As Partek gives high correlation I don't think that the sampling is the problem.
Forum: Bioinformatics 09-23-2011, 09:46 AM
Replies: 9
Views: 3,874
Posted By gfmgfm
Thanks for the replies. Very good questions. ...

Thanks for the replies.
Very good questions.

1. I haven't tried giving the same set twice. Anyway - I wouldn't like to have such differences - no matter where they come from.

2. Regarding the...
Forum: Bioinformatics 09-23-2011, 06:14 AM
Replies: 9
Views: 3,874
Posted By gfmgfm
After running the 2 sets I used cuffcompare to...

After running the 2 sets I used cuffcompare to combine all together. So cuffdiff was run with the same gtf for setA and setB.

I also ran cuffdiff for setA and setB on refseq gtf, and did not get...
Forum: Bioinformatics 09-22-2011, 01:26 AM
Replies: 9
Views: 3,874
Posted By gfmgfm
Cufflinks: a problem with the FPKM ratios?

Hi all,

I am getting inaccurate FPKM ratios after cufflinks. The same samples give low correlations of log 2 ratios (see attached scatter plot), which is very worrying.
Is this a bug in cufflinks...
Forum: Bioinformatics 09-05-2011, 11:24 PM
Replies: 3
Views: 2,083
Posted By gfmgfm
Thanks for the replies!

Thanks for the replies!
Forum: Bioinformatics 09-05-2011, 11:00 AM
Replies: 3
Views: 2,083
Posted By gfmgfm
detecting alternative splicing in RNA-seq

Hello,

In RNA seq analysis - I have aligned reads to the genome and estimated the abundance of known transcripts in each sample.

In the next step I would like to find genes which their "exon...
Forum: General 08-31-2011, 10:44 PM
Replies: 2
Views: 1,118
Posted By gfmgfm
I tried and it seems working. Did anyone else try?

I tried and it seems working. Did anyone else try?
Forum: Bioinformatics 08-22-2011, 04:18 AM
Replies: 0
Views: 1,288
Posted By gfmgfm
Scripture workflow

Hello,

I would like to use scripture in RNA seq experiments.

I thought of the following work-flow:

1. Align reads with Tophat.
2. For each biological sample separately: run scripture with...
Forum: Bioinformatics 06-14-2011, 04:01 AM
Replies: 6
Views: 3,509
Posted By gfmgfm
OK, thanks a lot. Is there any way to go from...

OK, thanks a lot.
Is there any way to go from cufflinks FPKM to DESeq?
Forum: Bioinformatics 06-14-2011, 02:36 AM
Replies: 6
Views: 3,509
Posted By gfmgfm
Thanks a lot! My data is in fpkm (after...

Thanks a lot!
My data is in fpkm (after cufflinks and cuffdiff). Is this an appropriate input to DESeq?
With such values - can I use DESeq to check for differential expression and to cluster the...
Showing results 1 to 25 of 64

 


All times are GMT -8. The time now is 02:27 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO