SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 1 of 1
Search took 0.00 seconds.
Search: Posts Made By: emacalate
Forum: Epigenetics 08-02-2016, 10:14 AM
Replies: 1
Views: 4,838
Posted By emacalate
Question ATAC-seq (Read1/Read2/Index Sequencing Primers?)

Hi,

We recently prepared samples for ATAC-seq using primers from the Buenrostro et al paper.

Ad1_noMX: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG
Ad2.1 ...
Showing results 1 to 1 of 1

 


All times are GMT -8. The time now is 04:13 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO