SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 71
Search took 0.00 seconds.
Search: Posts Made By: kaps
Forum: General 10-19-2015, 01:26 AM
Replies: 0
Views: 1,624
Posted By kaps
genbank submission

Dear all,

I am trying to submit sequences to genbank but I am told my records cannot be accepted because they contain bad annotation or internal stop
codons. How can I improve the quality of my...
Forum: General 09-24-2015, 06:39 AM
Replies: 8
Views: 1,831
Posted By kaps
in the above case, I have done a blastn so as to...

in the above case, I have done a blastn so as to detect any hits (several are obtained) but showed only one. my aim in this is first to identify the orientation of the alignment, whether its partial...
Forum: General 09-24-2015, 06:05 AM
Replies: 8
Views: 1,831
Posted By kaps
In case like the one below, is the CDS both 5'...

In case like the one below, is the CDS both 5' and 3' partial or its only 5' partial? and what is the correct start position?

Range 1: 673 to 1681GenBankGraphics
Next Match
Previous Match...
Forum: General 09-24-2015, 05:26 AM
Replies: 8
Views: 1,831
Posted By kaps
Ok. so in annotation, how do I know whether my...

Ok. so in annotation, how do I know whether my region is at 5' or 3' end? partial or complete?
Forum: General 09-24-2015, 03:06 AM
Replies: 8
Views: 1,831
Posted By kaps
coding regions

Hello,

how can I identify correct coding regions in a sequence--with the help of blast
Forum: General 06-10-2015, 02:52 AM
Replies: 3
Views: 1,058
Posted By kaps
I have looked at the link suggested and it...

I have looked at the link suggested and it appears the cowpea DNA used for BAC library preparation came from a back cross with a virus resistant variety? If that is the case then I think it would...
Forum: General 06-10-2015, 12:33 AM
Replies: 3
Views: 1,058
Posted By kaps
plant genomes at NCBI

Dear all,
There are genome sequences for various plants at ftp://ftp.ncbi.nlm.nih.gov/genomes/PLANTS/ which are of interest to me. However I cannot additional information about these sequences. I am...
Forum: General 06-02-2015, 05:37 AM
Replies: 4
Views: 1,213
Posted By kaps
The sequences differ in length. I have not...

The sequences differ in length. I have not checked whether there are repeats. how do I check for repeats?

I will read about dot plots using the link provided.

thanks
Forum: General 06-01-2015, 06:37 AM
Replies: 0
Views: 1,123
Posted By kaps
open reading frame finder

Dear all,

I have used NCBI ORF to find ORFs in my contig. My challenge is knowing where a given gene say P1, CP, etc starts or ends. Any clues to this? they are welcome
Forum: General 06-01-2015, 06:02 AM
Replies: 4
Views: 1,213
Posted By kaps
hi, My interest is to generate a Pairwise...

hi,

My interest is to generate a Pairwise sequence comparison matrix.
the blastn hits include both full length and partial. Seq identity matrix I posted were generated without clustalw...
Forum: General 06-01-2015, 03:25 AM
Replies: 7
Views: 4,003
Posted By kaps
Hello, I am using bioedit to do pairwise...

Hello,

I am using bioedit to do pairwise comparison of my sequences- then a pairwise seq matrix. Am not sure whether am following the steps well! here is how am doing it;
1. import seqs to...
Forum: General 05-31-2015, 10:52 PM
Replies: 4
Views: 1,213
Posted By kaps
bioedit vs blastn results

hello, I have blasted my contigs and obtained some hits with high percentage identities. I then retrieved the fasta files of those hits and computed sequence identity matrix using bioedit. I expected...
Forum: Bioinformatics 05-22-2015, 06:09 AM
Replies: 172
Views: 48,373
Posted By kaps
This is what I get: @No_name ...

This is what I get:
@No_name
CAACATTACCTAGTGCAAGACAGTGTTAATTTGAAGGCAGTTCATA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@No_name...
Forum: Bioinformatics 05-22-2015, 05:54 AM
Replies: 172
Views: 48,373
Posted By kaps
Hello, Why would bowtie abort with such a...

Hello,
Why would bowtie abort with such a command?

bowtie2 -p 2 -x CABFG -U clc_trim_pair4.fq -S S4_clc_trm.sam
Error: Read No_name has more quality values than read characters.
terminate...
Forum: General 05-22-2015, 05:07 AM
Replies: 18
Views: 4,738
Posted By kaps
its working. Thanks

its working.

Thanks
Forum: General 05-22-2015, 04:54 AM
Replies: 3
Views: 6,644
Posted By kaps
its working well Thanks

its working well

Thanks
Forum: General 05-22-2015, 04:04 AM
Replies: 3
Views: 6,644
Posted By kaps
converting fasta/fa files to fastq

Hello I seen a script on this link https://code.google.com/p/fasta-to-fastq/ that converts fasta to fastq either as standalone or unix workflow.

How can use I it either as standalone or unix?
Forum: Bioinformatics 05-22-2015, 12:51 AM
Replies: 10
Views: 19,789
Posted By kaps
Hello I seen a script on this link...

Hello I seen a script on this link https://code.google.com/p/fasta-to-fastq/ that converts fasta to fastq either as standalone or unix workflow.

How can use I it either as standalone or unix?
Forum: General 05-22-2015, 12:34 AM
Replies: 18
Views: 4,738
Posted By kaps
I have used a reference (comprising of 2...

I have used a reference (comprising of 2 sequences varying in length) to do alignment on paired end fastq files. I have generated the sam file but when i try converting it (sam) to bam, it is not...
Forum: General 05-21-2015, 05:58 AM
Replies: 17
Views: 2,379
Posted By kaps
Noted. it seems the webstart options are for...

Noted. it seems the webstart options are for standalone, mac or windows OS?

Did you say that Putty does not need a strong internet compared to Mobaxterm?
Forum: General 05-21-2015, 05:26 AM
Replies: 17
Views: 2,379
Posted By kaps
Hello, If am running IGV on putty, will the...

Hello, If am running IGV on putty, will the required version be, Binary Distribution?
Forum: RNA Sequencing 05-19-2015, 08:05 AM
Replies: 7
Views: 4,937
Posted By kaps
Noted. this option is further supported here:...

Noted. this option is further supported here: http://thegenomefactory.blogspot.com/2012/09/using-velvet-with-mate-pair-sequences.html.

I will not use shuffleSequences.pl!

Thanks
Forum: RNA Sequencing 05-19-2015, 07:36 AM
Replies: 7
Views: 4,937
Posted By kaps
Ok. I have copied shuffleSequences_fastq.pl to...

Ok. I have copied shuffleSequences_fastq.pl to my folder but when I run shuffling as; shuffleSequences_fastq.pl lib4_align.end1.fq lib4_align.end2.fq lib4_all_ends.fq.
I get an error as;
-bash:...
Forum: RNA Sequencing 05-19-2015, 06:47 AM
Replies: 7
Views: 4,937
Posted By kaps
Hi, How do I locate the contrib folder for velvet?

Hi, How do I locate the contrib folder for velvet?
Forum: General 05-19-2015, 04:51 AM
Replies: 18
Views: 4,738
Posted By kaps
I have generated fastq files (R1& R2) from the...

I have generated fastq files (R1& R2) from the mapped bam file and I am now interested in assembling those reads using velvet. I need guidance to how to run velveth, velvetg and viewing the output.
Showing results 1 to 25 of 71

 


All times are GMT -8. The time now is 07:36 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO