SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 51
Search took 0.00 seconds.
Search: Posts Made By: ardmore
Forum: Bioinformatics 11-29-2011, 02:01 PM
Replies: 2
Views: 2,801
Posted By ardmore
Ignore it. I got it by using pure python.

Ignore it. I got it by using pure python.
Forum: Bioinformatics 11-29-2011, 10:18 AM
Replies: 2
Views: 2,801
Posted By ardmore
Can Biopython parse fastq file?

Like so many other Fastq parsers, I made the assumption of a four-line format, but samtools produces a fastq format where sequence and quality runs over multiple lines.
Can Biopyhton accomodate this...
Forum: Bioinformatics 11-16-2011, 07:29 AM
Replies: 6
Views: 16,950
Posted By ardmore
I understand your concern. But I am not a student...

I understand your concern. But I am not a student for my course worker. Actually my major is not bioinformatics but I am doing daily bioinformatics project. Maybe I selected a wrong career? I don't...
Forum: Bioinformatics 11-16-2011, 07:00 AM
Replies: 6
Views: 16,950
Posted By ardmore
Fastq to Fasta

Hello I want to convert fastq to fasta, by google search I got a perl code.
http://edwards.sdsu.edu/labsite/index.php/bas/309-converting-fastq-to-fasta-and-qual
However my perl knowledge is almost...
Forum: Bioinformatics 11-15-2011, 04:59 PM
Replies: 6
Views: 1,237
Posted By ardmore
Oop. I did make a mistake. I misread the command....

Oop. I did make a mistake. I misread the command. My goal is to get a fasta file. I didn't pay attention to it.

So how can I get the fasta file?
Convert fastq to fasta?
or using mpileup?...
Forum: Bioinformatics 11-15-2011, 03:02 PM
Replies: 6
Views: 1,237
Posted By ardmore
Okay. Can we read quality scores based on the...

Okay. Can we read quality scores based on the fasta file?
I google search but no clue.
Forum: Bioinformatics 11-15-2011, 12:45 PM
Replies: 6
Views: 1,237
Posted By ardmore
I am not strong on perl. So could you please...

I am not strong on perl. So could you please advise me the details?
How can I get the right sequence?
Forum: Bioinformatics 11-15-2011, 12:32 PM
Replies: 6
Views: 1,237
Posted By ardmore
Wild output

Hello, I am tring to generate the consensus sequence by using commandsamtools pileup -cf ref.fa aln.bam | samtools.pl pileup2fq -D100 > cns.fastq

However I found that in the output file there are...
Forum: Bioinformatics 11-15-2011, 09:23 AM
Replies: 8
Views: 3,990
Posted By ardmore
Thank you.

Thank you.
Forum: Bioinformatics 11-15-2011, 08:21 AM
Replies: 8
Views: 3,990
Posted By ardmore
It is from a bam file output. If we define a...

It is from a bam file output. If we define a region such as chr22:10000-20000.
And we get the consensus sequence, we only interest one small region around a specific position.
How to?
Forum: Bioinformatics 11-15-2011, 07:44 AM
Replies: 8
Views: 3,990
Posted By ardmore
My question is not for C#. I meant that I am not...

My question is not for C#. I meant that I am not sure whether the sequence is defined as 0 based or not. The sequence is a fasta file or extracted from a genome.
Forum: Bioinformatics 11-15-2011, 07:17 AM
Replies: 8
Views: 3,990
Posted By ardmore
Okay. If the sequence is given and a position...

Okay. If the sequence is given and a position 63150935 is given as well. I want to get 1000kb size around this point by C#.
Then
string trunk = sequence.Substring(63150935-500000,1000000);
or...
Forum: Bioinformatics 11-15-2011, 06:35 AM
Replies: 8
Views: 3,990
Posted By ardmore
fasta sequence: 0 based or 1 based index

When we say the position of a sequence, is zero based or one based?
Because I want to extract a sub sequence from a long one.
AGCTTT
012345

OR
AGCTTT
123456
Thanks.
Forum: Bioinformatics 11-14-2011, 02:18 PM
Replies: 9
Views: 5,802
Posted By ardmore
Well. I think that it is the bug of samtools...

Well. I think that it is the bug of samtools manual.
I used the command
samtools pileup -cf ref.fa aln.bam | samtools.pl pileup2fq -D100 > cns.fastq

Everything is fine.
Forum: Bioinformatics 11-14-2011, 09:13 AM
Replies: 9
Views: 5,802
Posted By ardmore
I have the same question. I used the command ...

I have the same question. I used the command
samtools mpileup -uf ref.fa aln.bam | bcftools view -cg - | vcfutils.pl vcf2fq > cns.fq
However I got an error.
the 'Argument f isnt numeric in...
Forum: Bioinformatics 11-11-2011, 12:57 PM
Replies: 11
Views: 13,911
Posted By ardmore
Thank you very much. Your statements are much...

Thank you very much. Your statements are much clearer than his. Could you please give me a quick command sample to get a sequence based on my reads? I am not strong on it.
samtools mpileup -uf...
Forum: Bioinformatics 11-11-2011, 12:41 PM
Replies: 11
Views: 13,911
Posted By ardmore
Well, I don't think he answered my question...

Well, I don't think he answered my question although I market it as an answer.
So I posted it here to see if anybody can help me. He just extract the sequence from the reference rather than the read.
Forum: Bioinformatics 11-11-2011, 12:31 PM
Replies: 11
Views: 13,911
Posted By ardmore
Should we consider the flag such as 165,1113...

Should we consider the flag such as 165,1113 etc.?
Which one should be selected for the position 14430092?
NNNNCNAGCNGAGCGNNTCTGGG
NNNNNNNNNNNTNNNNNNNNANN
CCTCGCGGGACTGGTATGGGGAC
Forum: Bioinformatics 11-11-2011, 11:54 AM
Replies: 11
Views: 13,911
Posted By ardmore
Follow up: The question is if you select column...

Follow up:
The question is if you select column 10, there are many different segments with the same position. For example:
...
Forum: Bioinformatics 11-11-2011, 11:18 AM
Replies: 11
Views: 13,911
Posted By ardmore
To get the sequence from a given BAM file

Hello, need help for samtools or other methods.

You know that the Sequence Alignment/Map (SAM) format is a generic alignment format for storing read alignments against reference sequences. If a...
Forum: Bioinformatics 11-11-2011, 10:06 AM
Replies: 1
Views: 979
Posted By ardmore
next segment.

Here are some terms definition from samtools manual.
Template: A DNA/RNA sequence part of which is sequenced on a sequencing machine or assembled
from raw sequences.
Segment: A contiguous...
Forum: Bioinformatics 11-11-2011, 06:51 AM
Replies: 2
Views: 1,563
Posted By ardmore
About FLAG

http://samtools.sourceforge.net/SAM1.pdf

FLAG: bitwise FLAG. Each bit is explained in the following table:
Bit Description
0x1 template having multiple segments in sequencing
0x2 each segment...
Forum: Bioinformatics 11-10-2011, 03:31 PM
Replies: 2
Views: 1,214
Posted By ardmore
I am not sure which way is better. The sequence...

I am not sure which way is better. The sequence is 20kb, the reference genome sequence is about 8gb~100gb.
Forum: Bioinformatics 11-10-2011, 11:54 AM
Replies: 2
Views: 1,214
Posted By ardmore
How big the sequence is allowed?

http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&PROG_DEF=blastn&BLAST_PROG_DEF=megaBlast&BLAST_SPEC=blast2seq
Suppose I use blast to align two sequences, how big the sequence is...
Forum: Bioinformatics 11-10-2011, 06:21 AM
Replies: 10
Views: 2,444
Posted By ardmore
I feel that it is very hard to use "DupMasker",...

I feel that it is very hard to use "DupMasker", is there a tutorial?
Showing results 1 to 25 of 51

 


All times are GMT -8. The time now is 09:49 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO