SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 61
Search took 0.00 seconds.
Search: Posts Made By: suludana
Forum: Illumina/Solexa 12-07-2011, 01:53 AM
Replies: 1
Views: 1,085
Posted By suludana
Question Exome and mRNA coverages

Hi,
what coverages are you using in your projects of exome resequencing and de novo mRNA? The most recent publications are different in terms of these values ​​and Illumina does not recommend...
Forum: Illumina/Solexa 04-28-2011, 04:43 AM
Replies: 4
Views: 2,126
Posted By suludana
Hi, the necesary coverage depends on the...

Hi,

the necesary coverage depends on the proyect you are performing. For instance, if you are doing de novo sequencing probably you will need at least 30-50x, but if you are doing resequencing a...
Forum: Illumina/Solexa 04-27-2011, 12:59 AM
Replies: 12
Views: 4,019
Posted By suludana
Thanks for your comments, but my question is: Do...

Thanks for your comments, but my question is: Do I lose the advantages of the PE if the reads overlap?
Forum: Illumina/Solexa 04-20-2011, 07:58 AM
Replies: 12
Views: 4,019
Posted By suludana
Thanks for all your comments. If I were to look...

Thanks for all your comments.
If I were to look only SNPs, I have no doubt: I will use the overlapping reads of 100 bp. But I am interested also in big INDELs and rearrangements. In this case a real...
Forum: Illumina/Solexa 04-20-2011, 12:21 AM
Replies: 12
Views: 4,019
Posted By suludana
Question Overlap of paired-end reads

Hi,
we are starting to analyze a PE 100 run of a resequencing project. Unfortunately the library is too short and the majority of paired-end reads overlap. In this study we are interested in SNPs,...
Forum: Illumina/Solexa 02-09-2011, 07:12 AM
Replies: 8
Views: 4,976
Posted By suludana
Yes, following the D.Craig paper (Nature Methods,...

Yes, following the D.Craig paper (Nature Methods, 2008).
It works fine.
Forum: Illumina/Solexa 10-07-2010, 03:27 AM
Replies: 5
Views: 3,532
Posted By suludana
Uppps, it seems there is an update for v1.5: ...

Uppps, it seems there is an update for v1.5:

ATCTCGTATGCCGTCTTCTGCTTG
Forum: Sample Prep / Library Generation 10-07-2010, 02:59 AM
Replies: 41
Views: 25,944
Posted By suludana
Hi Lee, could you please tell me your...

Hi Lee,
could you please tell me your experience with the Kappa standards? I am working with Kapa kits to perform the qPCR but not with their standards.
Thanks
Forum: Illumina/Solexa 10-07-2010, 02:52 AM
Replies: 5
Views: 3,532
Posted By suludana
Thanks Niko!

Thanks Niko!
Forum: Illumina/Solexa 10-07-2010, 02:45 AM
Replies: 5
Views: 3,532
Posted By suludana
Thank you François. I know this list. The...

Thank you François.

I know this list. The point is that I have some dificulties to understand which is the adapter I will find in the final of the reads.
Forum: Illumina/Solexa 10-07-2010, 01:30 AM
Replies: 5
Views: 3,532
Posted By suludana
Question small RNA Adapter

Hi,

could anyone confirm me that the adapter sequence we should remove from the small RNA reads, before the analysis, is:

5’-TCGTATGCCGTCTTCTGCTTG-3’

Thank you very much.
Forum: Illumina/Solexa 10-07-2010, 12:52 AM
Replies: 0
Views: 1,068
Posted By suludana
Question Chip-Seq Analysis

Hi all,

I think I need some help:

We performed a Chip-Seq single read run of 36 cycles.

It was curious to verify that some of the libraries produced much more peaks.

We have 7 samples,...
Forum: Illumina/Solexa 09-08-2010, 12:07 AM
Replies: 22
Views: 10,384
Posted By suludana
Do you mean spend a Flow Cell to determine the...

Do you mean spend a Flow Cell to determine the exact density?
Forum: Illumina/Solexa 09-07-2010, 06:37 AM
Replies: 2
Views: 1,913
Posted By suludana
mRNAseq coverage

Hi,
I would like to know the approximate coverage obtained in a Human mRNAseq PE run (100+100 bp).
I know that it is difficult to estimate the approximate size of the transcriptome, and of course...
Forum: Illumina/Solexa 09-07-2010, 06:32 AM
Replies: 9
Views: 3,140
Posted By suludana
Agilent Prices for exome capture (SureSelect...

Agilent Prices for exome capture (SureSelect Human All Exon Plus):

- 5 exomes: 6349 euros
-10 exomes: 11005 euros
- 25 exomes: 25396 euros
-50 exomes: 46559 euros


You could consult the...
Forum: Illumina/Solexa 08-26-2010, 08:28 AM
Replies: 7
Views: 23,382
Posted By suludana
Hi, very interesting the link. Could you...

Hi, very interesting the link.
Could you please tell me if you need to do a second read for detect the index or with a single read run it is enough?
Forum: Illumina/Solexa 08-26-2010, 08:16 AM
Replies: 20
Views: 7,217
Posted By suludana
Are you talking about the preparation of Genomic...

Are you talking about the preparation of Genomic DNA?
Forum: Illumina/Solexa 08-17-2010, 02:32 AM
Replies: 16
Views: 5,185
Posted By suludana
What about the runs without PhiX but with the...

What about the runs without PhiX but with the need of a posterior normalization (using PhiX from a previus run)? In this case we need the images, isn't it?
Forum: Illumina/Solexa 08-16-2010, 08:53 AM
Replies: 22
Views: 10,384
Posted By suludana
Question Library quantification

Hi,
I am using qPCR and Bioanalyzer to quantify my libraries before sequencing in a GAII. Even so I still can not get it right. Each run is a surprise (not always good). Does anyone have a really...
Forum: Bioinformatics 06-11-2010, 04:28 AM
Replies: 2
Views: 1,601
Posted By suludana
Chip-Seq Data

Hi,

I am starting to analyse my first Chip-Seq experiment (using an histone antibody).
I obtained thousands of peaks.
After using two filters (read number/peak and control sample no IP) I...
Forum: Illumina/Solexa 06-10-2010, 02:00 AM
Replies: 0
Views: 1,143
Posted By suludana
Question Chip-Seq Data

Hi,

I am starting to analyse my first Chip-Seq experiment (using an histone antibody).
I obtained thousands of peaks.
After using two filters (read number/peak and control sample no IP) I...
Forum: Bioinformatics 06-08-2010, 09:46 AM
Replies: 2
Views: 1,285
Posted By suludana
Hi, thanks for your post. The true is that I...

Hi,
thanks for your post.
The true is that I am completly lost in this analysis.
I have 5 samples and 2 controls (no IP samples). 3 of the samples goes with one of the controls and the other 2...
Forum: Illumina/Solexa 06-04-2010, 05:28 AM
Replies: 2
Views: 1,694
Posted By suludana
Do you think it would be correct to adjust...

Do you think it would be correct to adjust filters based on some housekeeping genes?
Forum: Bioinformatics 06-03-2010, 07:24 AM
Replies: 2
Views: 1,285
Posted By suludana
Question Chip-Seq Analysis

Hi

I am analyzing my first data of Chip-Seq (with the antibody H4K16Ac) using Partek.

In the initial step of detecting peaks I obtained a lot of peaks for some of the samples (100.000 –...
Forum: Illumina/Solexa 06-03-2010, 07:21 AM
Replies: 2
Views: 1,694
Posted By suludana
Question Chip-Seq Analisis

I am analyzing my first data of Chip-Seq (with the antibody H4K16Ac) using Partek.

In the initial step of detecting peaks I obtained a lot of peaks for some of the samples (100.000 – 200.000) and...
Showing results 1 to 25 of 61

 


All times are GMT -8. The time now is 01:00 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO