Forum: Bioinformatics
12-03-2012, 11:38 PM
|
|
Replies: 4
Views: 1,282
How to merge the annotations
Hello,
I have the lincRNA annotation file from UCSC NR*, GENCODE, and other published lincRNA collections. However, i want to merge them into one larger lincRNA collections. what pipeline can do...
|
|
Forum: Bioinformatics
11-16-2012, 05:38 AM
|
|
Replies: 2
Views: 3,434
|
|
Forum: Bioinformatics
11-16-2012, 12:45 AM
|
|
Replies: 2
Views: 3,434
How to Make Wiggle file from RNA-seq bam
Hello all,
I use Tophat to align the RNAseq reads to human genome. However, I want to visualize the coverage across the regions of interest.
I know that the IGV can show the wiggles (or...
|
|
Forum: Bioinformatics
04-30-2012, 07:02 PM
|
|
Replies: 8
Views: 1,837
|
|
Forum: Bioinformatics
04-30-2012, 06:55 PM
|
|
Replies: 8
Views: 1,837
The bowite manual says "-M <int> like...
The bowite manual says "-M <int> like -m, but reports 1 random hit (MAPQ=0); requires --best "
This is to say if the read align more than <int>, then it will suppress all the alignments....
|
|
Forum: Bioinformatics
04-30-2012, 06:50 PM
|
|
Replies: 8
Views: 1,837
|
|
Forum: Bioinformatics
04-30-2012, 12:16 AM
|
|
Replies: 8
Views: 1,837
bowtie -M
I wanna map the small RNA reads to the reference C. elegans genome.
for example:
>test.fa
GGGAATCCTGGATGTTGTAAGCTT
which has 15 copies in the genome.
BLAT Search Results
|
|
Forum: Bioinformatics
04-11-2012, 04:23 AM
|
|
Replies: 3
Views: 5,319
|
|
Forum: Bioinformatics
09-21-2011, 07:40 AM
|
|
Replies: 1
Views: 2,103
cufflinks output against annotation file
hello, everyone,
i run the cufflinks to calculate the RPKM(or FPKM) for annotated genes for C.elegans.
i type in the command.
cufflinks -p 8 -G WormBase190/ce6_sangerRNA.gtf N2.sort.bam
...
|
|
Forum: Bioinformatics
09-20-2011, 07:32 PM
|
|
Replies: 6
Views: 4,391
an error when run cufflinks
When i run cufflinks, the error occurs:
cufflinks: error while loading shared libraries: libboost_thread.so.1.47.0: cannot open shared object file: No such file or directory
it may be the...
|
|
Forum: Bioinformatics
09-13-2011, 06:58 PM
|
|
Replies: 5
Views: 25,653
|
|
Forum: Bioinformatics
09-13-2011, 06:38 PM
|
|
Replies: 2
Views: 1,818
thanks.
I have passed the configure step for...
thanks.
I have passed the configure step for cufflinks.
however, the make step did not work. why?
make all-recursive
make[1]: Entering directory `/home/wgf/cufflinks-1.1.0'
Making all in...
|
|
Forum: Bioinformatics
09-13-2011, 07:47 AM
|
|
Replies: 2
Views: 1,818
bjam for cufflinks
Hi, all guys,
Before the install of cufflinks, it need the bjam of boost.
the step i typed is :
(1) ./bootstrap.sh
(2) cp bjam ~/bin
(3) bjam --prefix=/home/wxf/ --toolset=gcc...
|
|
Forum: Bioinformatics
09-06-2011, 08:25 PM
|
|
Replies: 2
Views: 3,169
This is the output of Tophat.
[Wed Sep 7...
This is the output of Tophat.
[Wed Sep 7 10:52:44 2011] Beginning TopHat run (v1.3.1)
-----------------------------------------------
[Wed Sep 7 10:52:44 2011] Preparing output location...
|
|
Forum: Bioinformatics
09-05-2011, 12:04 AM
|
|
Replies: 2
Views: 3,169
How to run Tophat with annotation file
Hi, i want to map the single-end short reads to the genome.
first, i map the reads to the genome with bowtie.
second, for the unaligned reads, i want to map it across the annotation file. i...
|
|
Forum: Bioinformatics
05-04-2011, 06:35 PM
|
|
Replies: 6
Views: 2,048
|
|
Forum: Bioinformatics
12-08-2010, 06:26 PM
|
|
Replies: 5
Views: 2,722
|
|
Forum: Bioinformatics
12-08-2010, 06:20 PM
|
|
Replies: 5
Views: 2,722
|
|
Forum: Bioinformatics
12-08-2010, 06:15 PM
|
|
Replies: 5
Views: 2,722
|
|
Forum: Bioinformatics
12-08-2010, 07:09 AM
|
|
Replies: 5
Views: 2,722
|
|
Forum: Bioinformatics
11-13-2010, 05:32 AM
|
|
Replies: 4
Views: 3,106
an error when using cufflinks
hi.
i have installed samtools and boost librarires.
after that, i download the cufflinks source code because my linux is 32-bit.
Everything went fine. However, when I tested using cufflinks...
|
|
Forum: Bioinformatics
10-31-2010, 03:35 AM
|
|
Replies: 3
Views: 4,497
|
|
Forum: Bioinformatics
10-31-2010, 01:01 AM
|
|
Replies: 3
Views: 4,497
|
|
Forum: Bioinformatics
10-29-2010, 08:21 PM
|
|
Replies: 6
Views: 2,048
|
|
Forum: Bioinformatics
10-29-2010, 06:09 AM
|
|
Replies: 4
Views: 1,863
The Tophat depend on samtools, so you first...
The Tophat depend on samtools, so you first should install samtools correctly.
here is the manual about samtools' install.
http://cufflinks.cbcb.umd.edu/tutorial.html
after this, choose your...
|
