SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 30
Search took 0.00 seconds.
Search: Posts Made By: masylichu
Forum: Bioinformatics 12-03-2012, 11:38 PM
Replies: 4
Views: 1,282
Posted By masylichu
How to merge the annotations

Hello,

I have the lincRNA annotation file from UCSC NR*, GENCODE, and other published lincRNA collections. However, i want to merge them into one larger lincRNA collections. what pipeline can do...
Forum: Bioinformatics 11-16-2012, 05:38 AM
Replies: 2
Views: 3,434
Posted By masylichu
Thank you. I have successfully made it.

Thank you. I have successfully made it.
Forum: Bioinformatics 11-16-2012, 12:45 AM
Replies: 2
Views: 3,434
Posted By masylichu
How to Make Wiggle file from RNA-seq bam

Hello all,

I use Tophat to align the RNAseq reads to human genome. However, I want to visualize the coverage across the regions of interest.

I know that the IGV can show the wiggles (or...
Forum: Bioinformatics 04-30-2012, 07:02 PM
Replies: 8
Views: 1,837
Posted By masylichu
The bowtie2 is particularly good at aligning...

The bowtie2 is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters. Here, i used bowtie to map the small reads.
Forum: Bioinformatics 04-30-2012, 06:55 PM
Replies: 8
Views: 1,837
Posted By masylichu
The bowite manual says "-M <int> like...

The bowite manual says "-M <int> like -m, but reports 1 random hit (MAPQ=0); requires --best "

This is to say if the read align more than <int>, then it will suppress all the alignments....
Forum: Bioinformatics 04-30-2012, 06:50 PM
Replies: 8
Views: 1,837
Posted By masylichu
YES. so -a options should not be used under this...

YES. so -a options should not be used under this condition.
Forum: Bioinformatics 04-30-2012, 12:16 AM
Replies: 8
Views: 1,837
Posted By masylichu
bowtie -M

I wanna map the small RNA reads to the reference C. elegans genome.

for example:
>test.fa
GGGAATCCTGGATGTTGTAAGCTT

which has 15 copies in the genome.


BLAT Search Results
Forum: Bioinformatics 04-11-2012, 04:23 AM
Replies: 3
Views: 5,319
Posted By masylichu
If the version of your R is 2.14, the problem...

If the version of your R is 2.14, the problem will disappear.
Forum: Bioinformatics 09-21-2011, 07:40 AM
Replies: 1
Views: 2,103
Posted By masylichu
cufflinks output against annotation file

hello, everyone,

i run the cufflinks to calculate the RPKM(or FPKM) for annotated genes for C.elegans.

i type in the command.
cufflinks -p 8 -G WormBase190/ce6_sangerRNA.gtf N2.sort.bam
...
Forum: Bioinformatics 09-20-2011, 07:32 PM
Replies: 6
Views: 4,391
Posted By masylichu
an error when run cufflinks

When i run cufflinks, the error occurs:

cufflinks: error while loading shared libraries: libboost_thread.so.1.47.0: cannot open shared object file: No such file or directory

it may be the...
Forum: Bioinformatics 09-13-2011, 06:58 PM
Replies: 5
Views: 25,653
Posted By masylichu
fastq-dump

fastq-dump
Forum: Bioinformatics 09-13-2011, 06:38 PM
Replies: 2
Views: 1,818
Posted By masylichu
thanks. I have passed the configure step for...

thanks.

I have passed the configure step for cufflinks.

however, the make step did not work. why?

make all-recursive
make[1]: Entering directory `/home/wgf/cufflinks-1.1.0'
Making all in...
Forum: Bioinformatics 09-13-2011, 07:47 AM
Replies: 2
Views: 1,818
Posted By masylichu
bjam for cufflinks

Hi, all guys,

Before the install of cufflinks, it need the bjam of boost.

the step i typed is :

(1) ./bootstrap.sh
(2) cp bjam ~/bin
(3) bjam --prefix=/home/wxf/ --toolset=gcc...
Forum: Bioinformatics 09-06-2011, 08:25 PM
Replies: 2
Views: 3,169
Posted By masylichu
This is the output of Tophat. [Wed Sep 7...

This is the output of Tophat.

[Wed Sep 7 10:52:44 2011] Beginning TopHat run (v1.3.1)
-----------------------------------------------
[Wed Sep 7 10:52:44 2011] Preparing output location...
Forum: Bioinformatics 09-05-2011, 12:04 AM
Replies: 2
Views: 3,169
Posted By masylichu
How to run Tophat with annotation file

Hi, i want to map the single-end short reads to the genome.

first, i map the reads to the genome with bowtie.

second, for the unaligned reads, i want to map it across the annotation file. i...
Forum: Bioinformatics 05-04-2011, 06:35 PM
Replies: 6
Views: 2,048
Posted By masylichu
hello, Luigi That may be the problem of...

hello, Luigi

That may be the problem of samtools installation.

please you check your installation of samtools, meanwhile, follow the instruction of tophat software.
Forum: Bioinformatics 12-08-2010, 06:26 PM
Replies: 5
Views: 2,722
Posted By masylichu
all right. i will have a try.

all right. i will have a try.
Forum: Bioinformatics 12-08-2010, 06:20 PM
Replies: 5
Views: 2,722
Posted By masylichu
also, the problem happen after i deleted the...

also, the problem happen after i deleted the space before ' ensGene'.
Forum: Bioinformatics 12-08-2010, 06:15 PM
Replies: 5
Views: 2,722
Posted By masylichu
> ls("package:GenomicFeatures") [1] "exons" ...

> ls("package:GenomicFeatures")
[1] "exons" "extractTranscriptsFromGenome"
[3] "introns" "transcripts"

this is the output.
Forum: Bioinformatics 12-08-2010, 07:09 AM
Replies: 5
Views: 2,722
Posted By masylichu
a question about the use of R package-GenomicFeatures

Hi,all
i want to use the R biocondunctor package-GenomicFeatures.and i follow the manual to install this package.

To install this package, start R and enter:

...
Forum: Bioinformatics 11-13-2010, 05:32 AM
Replies: 4
Views: 3,106
Posted By masylichu
an error when using cufflinks

hi.
i have installed samtools and boost librarires.
after that, i download the cufflinks source code because my linux is 32-bit.

Everything went fine. However, when I tested using cufflinks...
Forum: Bioinformatics 10-31-2010, 03:35 AM
Replies: 3
Views: 4,497
Posted By masylichu
you mean that the .sam file from bowtie alignment...

you mean that the .sam file from bowtie alignment should be converted into bam, and then be converted into bed.
Every alignment should be corresponding to one line of the bed file.

which code of...
Forum: Bioinformatics 10-31-2010, 01:01 AM
Replies: 3
Views: 4,497
Posted By masylichu
How to convert bowtie output to wig

Hi~,
Does anyone have a conversion tool or program for bowtie output to .wig format?
I need to visualize my aligment data on ucsc.
Forum: Bioinformatics 10-29-2010, 08:21 PM
Replies: 6
Views: 2,048
Posted By masylichu
thank you. i have solved this problem.

thank you. i have solved this problem.
Forum: Bioinformatics 10-29-2010, 06:09 AM
Replies: 4
Views: 1,863
Posted By masylichu
The Tophat depend on samtools, so you first...

The Tophat depend on samtools, so you first should install samtools correctly.

here is the manual about samtools' install.
http://cufflinks.cbcb.umd.edu/tutorial.html

after this, choose your...
Showing results 1 to 25 of 30

 


All times are GMT -8. The time now is 03:13 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO