SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 64
Search took 0.00 seconds.
Search: Posts Made By: r.rosati
Forum: Sample Prep / Library Generation Yesterday, 05:51 AM
Replies: 3
Views: 333
Posted By r.rosati
I'm late to the party, but alternatively, wash...

I'm late to the party, but alternatively, wash with ethanol again and vortex well. The ethanol should remove most of the air trapped in the precipitate, and at that point you could dry again and...
Forum: Ion Torrent Yesterday, 05:45 AM
Replies: 3
Views: 338
Posted By r.rosati
There have recently been a few discussions ...

There have recently been a few discussions (https://www.google.com/search?&q=opentrons+site%3Areddit.com%2Fr%2Flabrats)about them on Reddit; perhaps it might be a way to get in touch with people who...
Forum: Bioinformatics 06-08-2018, 05:15 AM
Replies: 7
Views: 266
Posted By r.rosati
Paraphrasing Stack Overflow, "What have you tried...

Paraphrasing Stack Overflow, "What have you tried so far?"
Forum: Ion Torrent 05-21-2018, 02:19 PM
Replies: 4
Views: 337
Posted By r.rosati
P.S.: There's a useful document from the...

P.S.: There's a useful document from the now-defunct IonCommunity called "How to assess a PGM sequencing run report". Do you have it? I don't know where Thermo would be storing it nowadays, if it...
Forum: Ion Torrent 05-21-2018, 02:11 PM
Replies: 4
Views: 337
Posted By r.rosati
Ciao Isabella! I see that the consensus key is...

Ciao Isabella!
I see that the consensus key is very low... I would think that you had an issue with either the polymerase or the sequencing primer... or with the run itself.
You do have a huge % of...
Forum: Sample Prep / Library Generation 05-11-2018, 05:14 AM
Replies: 4
Views: 390
Posted By r.rosati
Hi, they should be... Once you've passed the...

Hi,
they should be... Once you've passed the 2-minute minimum incubation time, then the tubes are supposed to be stable for 3 hours (Qubit dsDNA HS Assay guide...
Forum: Ion Torrent 05-10-2018, 11:53 AM
Replies: 4
Views: 337
Posted By r.rosati
Ciao Isabella! Some troubleshooting information...

Ciao Isabella!
Some troubleshooting information can be obtained from the report.
How did the consensus keys look?
Were the test fragments OK (according to the % 50AQ17 and histogram)?
If you...
Forum: Ion Torrent 05-04-2018, 09:14 AM
Replies: 2
Views: 783
Posted By r.rosati
Hi, If you could show a run report, that'd help...

Hi,
If you could show a run report, that'd help troubleshooting too.
Forum: General 05-04-2018, 08:42 AM
Replies: 6
Views: 2,370
Posted By r.rosati
We have a 4200 and a very proficient student of...

We have a 4200 and a very proficient student of mine tried to use it (per Thermo protocol re. Bioanalyzer) to quantify RNAseq libraries, but this didn't prove very reliable; she'd get a very...
Forum: RNA Sequencing 04-27-2018, 11:53 AM
Replies: 10
Views: 870
Posted By r.rosati
I meant like grepping for ...

I meant like grepping for
CTGGAGATTGTCTCGTACGGTTAAGAGCCTCCGCCC
(or any other fragment in the ERCC controls, I copy-pasted the one you wrote in a previous post)
Forum: RNA Sequencing 04-27-2018, 11:31 AM
Replies: 10
Views: 870
Posted By r.rosati
Here I am with makeshift solutions, but if you...

Here I am with makeshift solutions, but if you make the BAM into a SAM, you can `grep` it to see if the sequences are there.
Forum: Illumina/Solexa 04-24-2018, 05:04 AM
Replies: 4
Views: 662
Posted By r.rosati
It is actually easy to spot (see the table here...

It is actually easy to spot (see the table here (https://www.drive5.com/usearch/manual/quality_score.html)): in Phred + 33, capital letters are at the top end of the quality range (Phred score plus...
Forum: Ion Torrent 04-19-2018, 07:40 AM
Replies: 3
Views: 529
Posted By r.rosati
Thank you!

Thank you!
Forum: Ion Torrent 04-19-2018, 05:02 AM
Replies: 3
Views: 529
Posted By r.rosati
Hi, I can't help directly but I'd suggest you...

Hi, I can't help directly but I'd suggest you contact the administrator (galaxy.contact {a-t} curie.fr (https://galaxy-public.curie.fr/static/mentions_legales.txt)) and ask if they could share their...
Forum: Ion Torrent 04-16-2018, 08:10 AM
Replies: 1
Views: 535
Posted By r.rosati
I only have part of what you're looking for,...

I only have part of what you're looking for, namely, well dimensions; and unfortunately it doesn't cover the PII. However, here it is:
https://onlinelibrary.wiley.com/doi/pdf/10.1002/elps.201200424...
Forum: Illumina/Solexa 04-16-2018, 07:30 AM
Replies: 2
Views: 648
Posted By r.rosati
This patent record is a nice read regarding the...

This patent record is a nice read regarding the FuPa reagent:
https://patents.google.com/patent/US8728728B2/en
Forum: Bioinformatics 04-11-2018, 05:17 AM
Replies: 7
Views: 669
Posted By r.rosati
Thank you. I'm very curious to see the result of...

Thank you. I'm very curious to see the result of the survey!
Forum: Bioinformatics 04-10-2018, 12:10 PM
Replies: 7
Views: 669
Posted By r.rosati
I humbly disagree. In my opinion, the biological...

I humbly disagree. In my opinion, the biological reality is that genes encode multiple isoforms; naming an isoform as "principal" is an artificial layer which we apply to the "biological reality" to...
Forum: Bioinformatics 04-10-2018, 07:52 AM
Replies: 7
Views: 669
Posted By r.rosati
...Excuse me for my ignorance, but exactly, what...

...Excuse me for my ignorance, but exactly, what is the issue they're trying to address by deciding to implement a clinically-driven primary transcript?
Forum: Ion Torrent 02-26-2018, 05:52 AM
Replies: 1
Views: 1,095
Posted By r.rosati
Hi! There are three run reports publicly(*)...

Hi!
There are three run reports publicly(*) available for the 540 chip here:
https://apps.thermofisher.com/apps/publiclib/#/datasets

The "download" refers to just the PDF reports, but if you...
Forum: Ion Torrent 01-24-2018, 12:32 PM
Replies: 7
Views: 1,820
Posted By r.rosati
Ion Torrent sequencers comparison

Hello,
so, now Thermo has 8 Ion Torrent models (https://www.thermofisher.com/search/browse/category/us/en/602565?navId=10972%2B4294959573) for sale (for future reference: PGM, PGM-Dx, Proton, S5, S5...
Forum: Bioinformatics 11-29-2017, 03:56 AM
Replies: 2
Views: 474
Posted By r.rosati
I'm not experienced, but since nobody replied...

I'm not experienced, but since nobody replied yet: if in `makeblastdb` you chose to name the database "nt", then in `blastn` have you tried using this name, i.e. `-db nt` instead of the complete...
Forum: Ion Torrent 11-16-2017, 03:36 AM
Replies: 6
Views: 1,140
Posted By r.rosati
I see. Getting them right would take some...

I see. Getting them right would take some experimenting.
Forum: Ion Torrent 11-14-2017, 08:41 AM
Replies: 6
Views: 1,140
Posted By r.rosati
...I gave you a very unorthodox answer, didn't I?...

...I gave you a very unorthodox answer, didn't I? If you're working with diagnostics, I understand that you can't alter the chips. I'm afraid I don't have a solution then.
If you work on research...
Forum: Ion Torrent 11-14-2017, 08:23 AM
Replies: 6
Views: 1,140
Posted By r.rosati
What I mean is that the chips are apparently...

What I mean is that the chips are apparently labeled in batch. If you can attach a sticker with the right information on it, and I mean information taken from a real 318 chip (not the one image...
Showing results 1 to 25 of 64

 


All times are GMT -8. The time now is 11:20 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO