Forum: General
10-19-2015, 02:26 AM
|
|
Replies: 0
Views: 2,138
genbank submission
Dear all,
I am trying to submit sequences to genbank but I am told my records cannot be accepted because they contain bad annotation or internal stop
codons. How can I improve the quality of my...
|
|
Forum: General
09-24-2015, 07:39 AM
|
|
Replies: 8
Views: 2,196
|
|
Forum: General
09-24-2015, 07:05 AM
|
|
Replies: 8
Views: 2,196
|
|
Forum: General
09-24-2015, 06:26 AM
|
|
Replies: 8
Views: 2,196
|
|
Forum: General
09-24-2015, 04:06 AM
|
|
Replies: 8
Views: 2,196
coding regions
Hello,
how can I identify correct coding regions in a sequence--with the help of blast
|
|
Forum: General
06-10-2015, 03:52 AM
|
|
Replies: 3
Views: 1,296
I have looked at the link suggested and it...
I have looked at the link suggested and it appears the cowpea DNA used for BAC library preparation came from a back cross with a virus resistant variety? If that is the case then I think it would...
|
|
Forum: General
06-10-2015, 01:33 AM
|
|
Replies: 3
Views: 1,296
plant genomes at NCBI
Dear all,
There are genome sequences for various plants at ftp://ftp.ncbi.nlm.nih.gov/genomes/PLANTS/ which are of interest to me. However I cannot additional information about these sequences. I am...
|
|
Forum: General
06-02-2015, 06:37 AM
|
|
Replies: 4
Views: 1,650
|
|
Forum: General
06-01-2015, 07:37 AM
|
|
Replies: 0
Views: 1,367
open reading frame finder
Dear all,
I have used NCBI ORF to find ORFs in my contig. My challenge is knowing where a given gene say P1, CP, etc starts or ends. Any clues to this? they are welcome
|
|
Forum: General
06-01-2015, 07:02 AM
|
|
Replies: 4
Views: 1,650
hi,
My interest is to generate a Pairwise...
hi,
My interest is to generate a Pairwise sequence comparison matrix.
the blastn hits include both full length and partial. Seq identity matrix I posted were generated without clustalw...
|
|
Forum: General
06-01-2015, 04:25 AM
|
|
Replies: 7
Views: 4,769
Hello,
I am using bioedit to do pairwise...
Hello,
I am using bioedit to do pairwise comparison of my sequences- then a pairwise seq matrix. Am not sure whether am following the steps well! here is how am doing it;
1. import seqs to...
|
|
Forum: General
05-31-2015, 11:52 PM
|
|
Replies: 4
Views: 1,650
bioedit vs blastn results
hello, I have blasted my contigs and obtained some hits with high percentage identities. I then retrieved the fasta files of those hits and computed sequence identity matrix using bioedit. I expected...
|
|
Forum: Bioinformatics
05-22-2015, 07:09 AM
|
|
Replies: 172
Views: 54,877
This is what I get:
@No_name ...
This is what I get:
@No_name
CAACATTACCTAGTGCAAGACAGTGTTAATTTGAAGGCAGTTCATA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@No_name...
|
|
Forum: Bioinformatics
05-22-2015, 06:54 AM
|
|
Replies: 172
Views: 54,877
Hello,
Why would bowtie abort with such a...
Hello,
Why would bowtie abort with such a command?
bowtie2 -p 2 -x CABFG -U clc_trim_pair4.fq -S S4_clc_trm.sam
Error: Read No_name has more quality values than read characters.
terminate...
|
|
Forum: General
05-22-2015, 06:07 AM
|
|
Replies: 18
Views: 6,016
|
|
Forum: General
05-22-2015, 05:54 AM
|
|
Replies: 3
Views: 8,288
|
|
Forum: General
05-22-2015, 05:04 AM
|
|
Replies: 3
Views: 8,288
converting fasta/fa files to fastq
Hello I seen a script on this link https://code.google.com/p/fasta-to-fastq/ that converts fasta to fastq either as standalone or unix workflow.
How can use I it either as standalone or unix?
|
|
Forum: Bioinformatics
05-22-2015, 01:51 AM
|
|
Replies: 10
Views: 25,691
Hello I seen a script on this link...
Hello I seen a script on this link https://code.google.com/p/fasta-to-fastq/ that converts fasta to fastq either as standalone or unix workflow.
How can use I it either as standalone or unix?
|
|
Forum: General
05-22-2015, 01:34 AM
|
|
Replies: 18
Views: 6,016
I have used a reference (comprising of 2...
I have used a reference (comprising of 2 sequences varying in length) to do alignment on paired end fastq files. I have generated the sam file but when i try converting it (sam) to bam, it is not...
|
|
Forum: General
05-21-2015, 06:58 AM
|
|
Replies: 17
Views: 2,987
|
|
Forum: General
05-21-2015, 06:26 AM
|
|
Replies: 17
Views: 2,987
|
|
Forum: RNA Sequencing
05-19-2015, 09:05 AM
|
|
Replies: 7
Views: 5,711
|
|
Forum: RNA Sequencing
05-19-2015, 08:36 AM
|
|
Replies: 7
Views: 5,711
Ok. I have copied shuffleSequences_fastq.pl to...
Ok. I have copied shuffleSequences_fastq.pl to my folder but when I run shuffling as; shuffleSequences_fastq.pl lib4_align.end1.fq lib4_align.end2.fq lib4_all_ends.fq.
I get an error as;
-bash:...
|
|
Forum: RNA Sequencing
05-19-2015, 07:47 AM
|
|
Replies: 7
Views: 5,711
|
|
Forum: General
05-19-2015, 05:51 AM
|
|
Replies: 18
Views: 6,016
I have generated fastq files (R1& R2) from the...
I have generated fastq files (R1& R2) from the mapped bam file and I am now interested in assembling those reads using velvet. I need guidance to how to run velveth, velvetg and viewing the output.
|
