Forum: Bioinformatics
11-05-2013, 09:18 AM
|
Replies: 2
Views: 1,726
BW. thank you for the information!
Is -A:...
BW. thank you for the information!
Is -A: allelic depths which is the number of AD like example below that allelic depth is 0+2 =2 then I can set -A as a number based on the AD?
GT: AD:...
|
Forum: Bioinformatics
11-04-2013, 02:51 PM
|
Replies: 2
Views: 1,726
variant filtering of mouse whole exome sequencing
hi, I have general question here about exome sequencing variant filtering.
I have generated mouse exome variants data from several samples using my pipeline including BWA alignment, samtools, picard...
|
Forum: Bioinformatics
11-04-2013, 12:28 PM
|
Replies: 3
Views: 3,740
Hi, I may have the same problem as yours
I...
Hi, I may have the same problem as yours
I use
[$ variants_reduction.pl snps.annovar mm10db/ -protocol nonsyn_splicing,genomicSuperDups,SC_MOUSE_GENOMES.genotype.vcf,dominant -operation...
|
Forum: Bioinformatics
09-08-2013, 08:47 AM
|
Replies: 1
Views: 1,789
|
Forum: Bioinformatics
09-07-2013, 08:05 PM
|
Replies: 1
Views: 1,789
question about kmer content
HI, my kmer content report after I trim primer sequence was showed as followings, should I give up using these reads or continue trim them?
What situation that we should give up our reads for next...
|
Forum: Bioinformatics
09-05-2013, 11:43 AM
|
Replies: 8
Views: 3,608
|
Forum: Bioinformatics
09-04-2013, 03:26 PM
|
Replies: 2
Views: 4,591
|
Forum: Bioinformatics
09-04-2013, 10:42 AM
|
Replies: 1
Views: 1,171
|
Forum: Bioinformatics
09-04-2013, 10:34 AM
|
Replies: 1
Views: 1,171
Mapping with BWA
My question is that when we do mapping with BWA, suppose we have pair-end reads, is it necessary that both forward and reverse reads with the same length? I ask this question because my forward and...
|
Forum: Bioinformatics
09-04-2013, 09:25 AM
|
Replies: 8
Views: 3,608
|
Forum: Bioinformatics
09-04-2013, 08:48 AM
|
Replies: 8
Views: 3,608
My aim for above question is that I want to get...
My aim for above question is that I want to get rid of these reads which contain AGTTGATCCGGTCCTAGGCAGTGTAGATCTCGGTGGTCGCCGTATCATTA sequence. since the reads contained this 50bp sequence only account...
|
Forum: Bioinformatics
09-04-2013, 08:44 AM
|
Replies: 8
Views: 3,608
|
Forum: Bioinformatics
08-21-2013, 01:33 PM
|
Replies: 9
Views: 4,601
GenoMax,
I have splitted 400,000,000 tag...
GenoMax,
I have splitted 400,000,000 tag reads and grouped them into 6 separate files using OUTER 6 different barcode sequences. I want to confirm with you that the next step is to use my own...
|
Forum: Bioinformatics
08-20-2013, 03:41 PM
|
Replies: 9
Views: 4,601
Thanks GenoMax, That helps a lot!
So my data...
Thanks GenoMax, That helps a lot!
So my data ID lines do NOT have tags on them, is that mean my data has not been processed by the Illumina pipeline?
Can I ask Illumina company to re-add tags...
|
Forum: Bioinformatics
08-20-2013, 10:42 AM
|
Replies: 9
Views: 4,601
Thank you GenoMax,
Pretty sad is, I took...
Thank you GenoMax,
Pretty sad is, I took over someone's project without know much about the background/information of the original data (I can not get contact with that guy who prepare these data...
|
Forum: Genomic Resequencing
08-19-2013, 01:53 PM
|
Replies: 0
Views: 1,686
|
Forum: Bioinformatics
08-19-2013, 01:35 PM
|
Replies: 9
Views: 4,601
Reply GenoMax
GenoMax,
Thanks much for your answer. However, my problem now is how to manage and separate the forward/reverse reads by using my separate barcode files (generated by data 2), considering more...
|
Forum: Bioinformatics
08-19-2013, 12:45 PM
|
Replies: 9
Views: 4,601
|
Forum: Illumina/Solexa
08-19-2013, 12:28 PM
|
Replies: 0
Views: 1,559
|