Forum: Bioinformatics
05-18-2011, 05:10 AM
|
|
Replies: 42
Views: 106,824
|
|
Forum: Bioinformatics
05-17-2011, 12:46 PM
|
|
Replies: 3
Views: 2,769
|
|
Forum: Bioinformatics
05-17-2011, 12:33 PM
|
|
Replies: 3
Views: 2,769
|
|
Forum: Bioinformatics
04-14-2011, 11:14 AM
|
|
Replies: 42
Views: 106,824
|
|
Forum: Bioinformatics
06-28-2010, 10:59 AM
|
|
Replies: 2
Views: 1,682
|
|
Forum: Bioinformatics
06-28-2010, 10:58 AM
|
|
Replies: 2
Views: 1,682
BWA error
Dear all
I am having a very weird error when trying to build the BWA index for hg18 genome (masked). Do you have any experiences or idea? Thanks.
[jyli@lbg-comp3 maskedHG18]$ bwa index...
|
|
Forum: Bioinformatics
03-16-2010, 07:13 AM
|
|
Replies: 0
Views: 1,350
BWA question
Dear all,
We are using BWA (0.5.7 ) to align Illumina read to refseq database, however we encountered some strange results see following:
This is from a SE lane mapped against our hg19 custom...
|
|
Forum: Bioinformatics
03-05-2010, 08:06 AM
|
|
Replies: 2
Views: 1,448
|
|
Forum: Bioinformatics
03-04-2010, 08:39 AM
|
|
Replies: 2
Views: 1,448
BWA Segmantation fault
Dear all,
I have recently encountered a weird error with BWA (0.4.5)alignment. It runs fine to generate .sai file, but when I ran "bwa samse", I got "segmentation fault". The weird thing is...
|
|
Forum: Bioinformatics
10-29-2009, 01:09 PM
|
|
Replies: 1
Views: 1,965
tophat unmapped reads
Hi,
I was planning to extract the unmapped short reads when running tophat, where are those unmapped reads stored? is there any easy way to do this?
|
|
Forum: Bioinformatics
10-14-2009, 07:01 AM
|
|
Replies: 2
Views: 1,471
|
|
Forum: Bioinformatics
10-13-2009, 01:35 PM
|
|
Replies: 2
Views: 1,471
tophat on paired files
Dear all,
I am using tophat and ran into a simple error. When I put in more pairs in the command, it failed complaining not being able to open the files.
Any comment is appreciated...
What...
|
|
Forum: Bioinformatics
10-13-2009, 12:06 PM
|
|
Replies: 6
Views: 3,338
|
|
Forum: Bioinformatics
10-12-2009, 12:20 PM
|
|
Replies: 9
Views: 3,309
|
|
Forum: Bioinformatics
09-01-2009, 05:40 AM
|
|
Replies: 9
Views: 3,309
MAQ error
I am using MAQ 0.7.1 and I recently encountered a weird errors:
-- maq-0.7.1
[ma_load_reads] loading reads...
[ma_load_reads] set length of the first read as 35.
[ma_load_reads] 17547636*2...
|
|
Forum: Bioinformatics
02-16-2009, 09:04 AM
|
|
Replies: 2
Views: 2,933
MAQ error
When I tried to run MAQ for alignment, I ran into errors like following:
maq: match.cc:557: int ma_match(int, char**): Assertion `fp_bfa' failed.
/ifs1/home/jyli/.lsbatch/1234799677.211076: line...
|
|
Forum: Bioinformatics
02-03-2009, 10:54 AM
|
|
Replies: 0
Views: 1,810
MAQ - segmentation error
Dear all,
I downloaded human transcripts from Ensemble. After I unzipped the file, I tried to use maq fasta2bfa command. Then I ran into an error "Segmentation error". Has anybody encountered such...
|
|
Forum: Illumina/Solexa
01-26-2009, 10:43 AM
|
|
Replies: 0
Views: 1,529
MAQ command
Hi all-
I have a question about MAQ software. At the website, http://maq.sourceforge.net/maq-man.shtml, one of the key commands listed was maq MATCH -param, etc. However in their manual...
|
|
Forum: Illumina/Solexa
01-12-2009, 10:31 AM
|
|
Replies: 20
Views: 8,930
|
|
Forum: Introductions
01-06-2009, 05:47 AM
|
|
Replies: 373
Views: 151,620
Happy New Year to you all!
I am new to this...
Happy New Year to you all!
I am new to this field, while I was working with Sanger's platform in the past. I am learning and hope to learn from you all.
Thanks for the initiative for getting...
|
|
Forum: Bioinformatics
11-13-2008, 01:07 PM
|
|
Replies: 514
Views: 225,327
Memory requirement on a window 32x
I tried to test human index downloaded from recommended site with the command
bowtie -c h_sapiens_asm ATTCAGTAGGTACTATAAATGGCCGAT
then, I got error:
Out of memory allocating ebwt[] in...
|
