SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read


Page 1 of 2 1 2
Showing results 1 to 25 of 29
Search took 0.00 seconds. Search: Posts Made By: ndeshpan
Forum: Bioinformatics 05-17-2016, 12:25 AM
Replies: 2
Views: 4,156
Posted By ndeshpan
GATK multisample vcf to BayeScan input

Hi all,

I am trying to convert a "multi-sample (population)" vcf file from GATK obtained using a "joint genotyping workflow" for a non-model organism. Since we want to do population studies, I...
Forum: Bioinformatics 02-24-2015, 04:05 PM
Replies: 0
Views: 1,555
Posted By ndeshpan
Exclamation reads mapping to highly similar genes using bowtie

Hi,
Good morning.

I have used bowtie to map reads to a bacterial genome. This genome contains a set of around 10 genes belonging to a specific family which show very high sequence similarity...
Forum: Bioinformatics 08-26-2014, 11:08 PM
Replies: 9
Views: 3,857
Posted By ndeshpan
Hi, I am trying to use Control-FREEC for...

Hi,

I am trying to use Control-FREEC for fungal genomes..

My config file looks like this
======
[general]

chrFiles = individual_Chr_fastaFiles
chrLenFile =...
Forum: Bioinformatics 09-03-2013, 06:28 PM
Replies: 2
Views: 1,858
Posted By ndeshpan
Thanks kokonech..I will try out these tools.. ...

Thanks kokonech..I will try out these tools..

Cheers,

Nandan
Forum: Bioinformatics 08-28-2013, 10:38 PM
Replies: 2
Views: 1,858
Posted By ndeshpan
Question detect DNA damage in NGS data

Hi ,

We have conducted an RNASeq experiment (control vs bacterial infection 3 replicates : host) and identified a few DE genes in the host which hint towards possible DNA damage regulation in...
Forum: Bioinformatics 07-21-2013, 04:59 PM
Replies: 2
Views: 2,207
Posted By ndeshpan
Thanks

Thanks, your link was very useful

cheers
Forum: Bioinformatics 07-18-2013, 11:52 PM
Replies: 2
Views: 2,207
Posted By ndeshpan
Exclamation Miseq de novo assembly : Ambigous base pairs (NNs) in the contigs

Hi,

I am using MiSeq paired-end reads (250X) coverage ..quality trimmed ..for de novo assembly using abyss ..

In the assembly (non-scaffolded file) I am getting streches of "NNNs" which I...
Forum: Bioinformatics 05-14-2013, 04:22 PM
Replies: 2
Views: 1,033
Posted By ndeshpan
Thanks Appreciate it..

Thanks Appreciate it..
Forum: Bioinformatics 05-13-2013, 11:01 PM
Replies: 2
Views: 1,033
Posted By ndeshpan
Can we do a complete smallRNA differential expression analysis using CLCBio

Hi all,

I was wondering if there is a clear way of going from raw reads to a list of differentially expressed miRNAs using the "CLCBio" genomics workbench?

appreciate any leads,

Ndeshpan
Forum: Bioinformatics 12-10-2012, 02:28 PM
Replies: 13
Views: 4,426
Posted By ndeshpan
Smile Thanks

Thanks Boetsie..Appreciate your help.

cheers,

Nandan
Forum: Bioinformatics 12-06-2012, 04:36 PM
Replies: 13
Views: 4,426
Posted By ndeshpan
Hi Boetsie, I have a question about a...

Hi Boetsie,

I have a question about a specific parameter in Sspace:

I am using SSPACE-BASIC-2.0_linux-x86_64

The ‘–m’ minimum overlap
---------------
Minimum number of overlapping bases of...
Forum: Bioinformatics 11-29-2012, 07:15 PM
Replies: 13
Views: 4,426
Posted By ndeshpan
Smile Thanks

Hi Anthony,

thanks for your response.. I will appreciate if u can share the script when you are ready with it.. I will also work from my end to check if I can get any solution ..now that there...
Forum: Bioinformatics 11-29-2012, 02:43 PM
Replies: 13
Views: 4,426
Posted By ndeshpan
Thumbs up Thanks

Hi Boetsie,

No worries..thanks .. I will check if anyone else has any suggestion and also get back to Hawkeye developers,,

cheers,

Nandan
Forum: Bioinformatics 11-28-2012, 10:25 PM
Replies: 13
Views: 4,426
Posted By ndeshpan
Hi Boetsie, One more quick question.. I...

Hi Boetsie,

One more quick question..

I am trying to use Hawkeye visualisation for displaying my "Scaffolds/contigs/reads" in tandem..

1) I have used velvet for assembly and created a ".afg"...
Forum: Bioinformatics 11-28-2012, 02:11 PM
Replies: 13
Views: 4,426
Posted By ndeshpan
Thanks

Thanks Boetsie..this solves my confusion :-)

cheers,

nandan
Forum: Bioinformatics 11-26-2012, 07:28 PM
Replies: 13
Views: 4,426
Posted By ndeshpan
Exclamation Sspace scaffolder : does it take the "insert size" or the "fragment size"

Hi all,

I am trying to use SSpace for scaffolding my already assembled contigs:

I wanted to know if the insert size column in the library.txt file for SSpace is the "insert size" exclusive of...
Forum: Bioinformatics 07-09-2012, 05:33 PM
Replies: 4
Views: 4,113
Posted By ndeshpan
Unhappy HiSeq small rna data adapter trimming using Adapter_trim.pl (mirTools)

Hi,

My HiSeq data for small RNA looks like this


@HWI-ST705:254:C0G8HACXX:5:1101:1674:1995 1:N:0:AGTCAA
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGT
+
CCCFFFFFHHHHHJJJJJJJIJJJJJJJJJJJJJH...
Forum: Bioinformatics 07-21-2011, 12:45 AM
Replies: 2
Views: 2,714
Posted By ndeshpan
DESeq input table upload

Hi,

I am new to DESeq (R version 2.13.1) and am trying to upload a tab delimited file.. (I am using the sample file "TagSeqExample.tab"), but I am getting an error..
...
Forum: Bioinformatics 07-18-2011, 05:46 PM
Replies: 0
Views: 1,644
Posted By ndeshpan
error using transcriptomic data (transabyss)

Hi ,

I was trying to assemble transcriptomic datasets (using abyss) for creating initial assemblies to be given as input for transabyss.

I got a segmentation fault.. (File attached with this...
Forum: Bioinformatics 07-08-2011, 08:04 PM
Replies: 14
Views: 28,167
Posted By ndeshpan
Thanks everyone

Thanks everyone
Forum: Bioinformatics 07-06-2011, 11:06 PM
Replies: 14
Views: 28,167
Posted By ndeshpan
hi, I have downloaded a file from SRA and...

hi,

I have downloaded a file from SRA and used fastq-dump..

However when I check my output .fastq file I see this



head -10 SRR036210.fastq
@SRR036210.1...
Forum: Bioinformatics 07-06-2011, 10:22 PM
Replies: 3
Views: 2,214
Posted By ndeshpan
Unhappy miRNA analysis

Hi all,

I am trying to work on a small RNA dataset generated using Illumina TruSeq™ Small RNA protocol.

I have run the data through the various tools specialised for miRNA analysis (such as...
Forum: Introductions 07-03-2011, 05:59 PM
Replies: 33
Views: 9,270
Posted By ndeshpan
Is the IGVViewer site down?

Is the IGVViewer site down?
Forum: Bioinformatics 06-14-2011, 10:44 PM
Replies: 2
Views: 4,514
Posted By ndeshpan
Thanks NicoBxl, I will use this now.. ...

Thanks NicoBxl,

I will use this now..

cheers

Nandan
Forum: Bioinformatics 06-09-2011, 11:42 PM
Replies: 2
Views: 4,514
Posted By ndeshpan
illumina smallRNA adapter sequence for downstram analysis + miRNA analysis steps

Hi all,

I have got two data-sets (36 bp) illumina reads from a smallRNA experiment.

Can anyone tell me what specific adapter sequence (sequence in ACGT) needs to be provided to the miRNA...
Showing results 1 to 25 of 29
Page 1 of 2 1 2

 


All times are GMT -8. The time now is 10:42 PM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO