
Go Back   SEQanswers > Search Forums

Showing results 1 to 25 of 73
Search took 0.02 seconds.
Search: Posts Made By: Palgrave
Forum: Bioinformatics 03-13-2017, 12:08 PM
Replies: 5
Views: 934
Posted By Palgrave
Thanks. It worked

Thanks. It worked
Forum: Bioinformatics 03-13-2017, 11:52 AM
Replies: 5
Views: 934
Posted By Palgrave
I think so. Any idea how to remove it?

I think so. Any idea how to remove it?
Forum: Bioinformatics 03-13-2017, 07:58 AM
Replies: 5
Views: 934
Posted By Palgrave
fastx_collapser: found invalid nucleotide sequence

Anyone know what the reason is?

fastx_collapser: found invalid nucleotide sequence (TCTTAACCCGGACCAGAAACTA ) on line 2

Forum: Bioinformatics 12-18-2015, 12:29 AM
Replies: 0
Views: 768
Posted By Palgrave
survival data from miRNA-Seq

I am looking for good tools to analyse survival data from miRNA-Seq. I have 80 patients samples with multiple clinical parameters.
Forum: General 11-11-2015, 03:27 AM
Replies: 0
Views: 1,036
Posted By Palgrave
BGI small RNA Seq

Does anyone know the price for sequencing incl library prep at BGI? I am thinking around 30 samples. How is the quality of the sequencing?
Forum: Sample Prep / Library Generation 11-02-2015, 02:40 PM
Replies: 4
Views: 1,121
Posted By Palgrave
I see the same in my positive control which is...

I see the same in my positive control which is suppose to be RNA of good quality.
Forum: Sample Prep / Library Generation 11-02-2015, 04:50 AM
Replies: 4
Views: 1,121
Posted By Palgrave
Weird bioanalyzer of stranded RNA library

What could be the reason for this bioanalyzer results for a total RNA stranded lib prep? I have been using the low mammalian input kit from clontech.
Forum: General 10-25-2015, 08:33 AM
Replies: 6
Views: 1,665
Posted By Palgrave
dsRNA oligo concentration

I have two RNA ssRNA oligos that I have annealed into a dsRNA duplex. The concentration of the two ssRNAs were 10uM. What is then the concentration of the dsRNA duplex?
Forum: General 10-14-2015, 08:26 AM
Replies: 3
Views: 9,750
Posted By Palgrave
I got 123 pmols or 123000nM. Does it look correct?

I got 123 pmols or 123000nM. Does it look correct?
Forum: General 10-14-2015, 08:17 AM
Replies: 3
Views: 9,750
Posted By Palgrave
ng/uL to uM conversion

I measured my DNA oligos to 1800ng/uL. The oligos are 22 nts long. Is there a way to convert this concentration into uM concentration? Does it depend very much of the nucleotide content?
Forum: Bioinformatics 09-21-2015, 02:43 PM
Replies: 1
Views: 995
Posted By Palgrave
Run bowtie on multiple files?

How do I set up bowtie to run through all my input files in a folder?
Assume my input files are in fasta format and named:


any my...
Forum: Bioinformatics 09-21-2015, 01:37 PM
Replies: 1
Views: 1,402
Posted By Palgrave
Get annotations by matching a fasta file to gff

I have a collapsed fasta files with all my counts and the corresponding sequences. I would like to annotate those sequences onto a gff file to find out what they are. Is this possible? Usually I...
Forum: Sample Prep / Library Generation 08-30-2015, 11:38 PM
Replies: 2
Views: 1,213
Posted By Palgrave
NEB small RNA library prep kits

Have anyone her tries the NEB small RNA library prep kit?
How is the result compared to the Illumina TruSeq?
Forum: Bioinformatics 10-03-2014, 06:02 AM
Replies: 3
Views: 2,071
Posted By Palgrave
adapter trimming miRNA sequencing

Below is the output from FastQC. Any idea what to trim for? Tried the Illumina Single End Adapter 1 but got no mapping. What are the A, and how do I get rid of them?

Forum: Bioinformatics 09-28-2014, 01:13 AM
Replies: 3
Views: 1,047
Posted By Palgrave
I have tried, but struggle to find a command that...

I have tried, but struggle to find a command that works.
Forum: Bioinformatics 09-27-2014, 03:19 PM
Replies: 3
Views: 1,047
Posted By Palgrave
Get loop sequence from miRBase

Does anyone know a way to extract the loop sequence from the miRNA hairpin. Basically I need to extract the part that is between the 3p- and 5p part of the hairpin.
Forum: Bioinformatics 09-24-2014, 04:30 PM
Replies: 4
Views: 1,118
Posted By Palgrave
>1-1377297 tgtaaacatcctcgactggaagct >2-783040...

Forum: Bioinformatics 09-24-2014, 04:24 PM
Replies: 4
Views: 1,118
Posted By Palgrave
COnverting collapsed reads to raw fasta

Does anyone have a trick or script to convert collapsed reads back to raw fasta reads? I need them in raw fasta to be able to map with bowtie.
a perl script maybe will do it?
Forum: Bioinformatics 07-24-2014, 11:06 PM
Replies: 1
Views: 919
Posted By Palgrave
extract miRNA-loop from miRBase

Does anyone have a good way to extract miRNA-loop sequences from the miRBase database?
Forum: Bioinformatics 03-01-2014, 01:59 AM
Replies: 2
Views: 1,023
Posted By Palgrave
match miRBase miRNAs to Targetscan

Dear everyone,
I was looking for a way to get targets for the miRBase miRNAs out of TargetScan. TargetScan mainly operates with families and often don't have information about 3p/5p for the...
Forum: Bioinformatics 01-02-2014, 04:15 PM
Replies: 2
Views: 4,047
Posted By Palgrave
Gene Ontology visualization tool.

What is the best tool for analyzing and visualazing gene ontologies at the moment? Any good suggestion?
Forum: Bioinformatics 12-29-2013, 02:54 PM
Replies: 0
Views: 904
Posted By Palgrave
CummeRbund findSimilar

Hi all,
How do I print unique transcript names from thr findSimilar function. Default is to print gene_id which correspond to multiple transcripts.
Forum: Bioinformatics 12-09-2013, 02:55 AM
Replies: 0
Views: 967
Posted By Palgrave
Cufflinks Refseq_ID output

Hi, what parameters in Cufflinks gives refseq output in addition to gene_id?
I am using the UCSC genes.gtf as reference.
Forum: Sample Prep / Library Generation 11-23-2013, 07:05 AM
Replies: 0
Views: 1,516
Posted By Palgrave


I am doing RNA-IP on a RNA-binding protein and have the following question:

What is the best way to elute the protein with the RNA from the beads to preserve RNA quality?
I was thinking of...
Forum: Bioinformatics 11-11-2013, 02:07 AM
Replies: 0
Views: 929
Posted By Palgrave
3'UTR Isoform from Cufflinks

Hi everyone,

I ran cuffdiff on treated/control samples to look for mRNA isoforms. I am especially interested in isoforms that affect 3'UTR lengths. Does anyone know how to pick out those isoforms...
Showing results 1 to 25 of 73


All times are GMT -8. The time now is 01:13 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO