SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 11 of 11
Search took 0.00 seconds.
Search: Posts Made By: essvee
Forum: Bioinformatics 08-01-2012, 05:40 AM
Replies: 5
Views: 18,440
Posted By essvee
or if your file is tabseq.tsv: A B ...

or if your file is tabseq.tsv:
A B 3233 223322 TAGGGCCTTAGGAAGCCTAA
C D 3234 222334 AGGTAACCGATAGAGGTCCA
you can use awk to do this easily:
awk '{print...
Forum: Bioinformatics 04-26-2012, 12:03 PM
Replies: 7
Views: 1,705
Posted By essvee
Post How do you backup?

Hi All,

Thought it would be interesting to see how everyone here is storing their sequencing data for the long-term.

So what are you using and why?
HDDs, DVDs, BD, tape, online, flash...
Forum: 454 Pyrosequencing 04-02-2012, 06:06 AM
Replies: 2
Views: 4,158
Posted By essvee
These are chimeras. You should look up chimera...

These are chimeras. You should look up chimera filtering software such as chimera slayer, perseus, or uchime. These can also be reduced by optimizing your PCR conditions.
Forum: Bioinformatics 03-15-2012, 11:52 AM
Replies: 9
Views: 3,377
Posted By essvee
Did not work? Can you please elaborate? Is it...

Did not work? Can you please elaborate? Is it still too big/small? It should work with both heatmap and heatmap2. If it is too large still, decrease the number. Also, try looking at help(heatmap) and...
Forum: Bioinformatics 03-15-2012, 07:04 AM
Replies: 9
Views: 3,377
Posted By essvee
Personally, I would experiment with the cexRow...

Personally, I would experiment with the cexRow value (start around 0.5 and go from there) and then save the heatmap as a pdf that I could modify further in illustrator or inkscape.
Hope that helps.
Forum: Bioinformatics 01-18-2012, 05:55 AM
Replies: 9
Views: 15,358
Posted By essvee
You can also use galaxy... under NGS: QC and...

You can also use galaxy... under NGS: QC and Manipulation there is a tool called 'Combine FASTA and QUAL into FASTQ'
Forum: Illumina/Solexa 08-11-2011, 04:52 AM
Replies: 1
Views: 3,802
Posted By essvee
In galaxy, I believe you can convert to ASCII...

In galaxy, I believe you can convert to ASCII offset 33 with the fastq groomer.
Forum: Bioinformatics 06-13-2011, 09:14 AM
Replies: 10
Views: 3,425
Posted By essvee
I do not believe you need to install any...

I do not believe you need to install any additional packages. It should be included in your standard installation.
There are a lot of tutorials floating around, I would suggest searching to find the...
Forum: Bioinformatics 06-13-2011, 04:55 AM
Replies: 10
Views: 3,425
Posted By essvee
In R there is fairly an easy to use function...

In R there is fairly an easy to use function called heatmap that will allow you to do this.
You can play with scales, colours, and formatting.
Hope this helps.
Forum: Bioinformatics 05-27-2011, 04:42 AM
Replies: 28
Views: 7,597
Posted By essvee
I suggest trying SeqTrim. You can set minimum...

I suggest trying SeqTrim.
You can set minimum quality based on a defined window size, minimum length, etc.
You can also run it command line, or online.
www.scbi.uma.es/seqtrim/
Forum: Bioinformatics 05-18-2011, 09:10 AM
Replies: 9
Views: 2,189
Posted By essvee
There is a fairly simple way, you were on the...

There is a fairly simple way, you were on the right track.

try:

awk '{print $7,$8,$9}' FS="," < (filename)

and then you can redirect the stdout to a new file
Hopefully this helps!
Showing results 1 to 11 of 11

 


All times are GMT -8. The time now is 10:08 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO