SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read


Page 1 of 3 1 23
Showing results 1 to 25 of 52
Search took 0.00 seconds. Search: Posts Made By: StephaniePi83
Forum: Bioinformatics 10-10-2016, 06:13 AM
Replies: 7
Views: 6,438
Posted By StephaniePi83
there are not that much reads mapping to the...

there are not that much reads mapping to the sequence of interest (maximum is 800 000 reads ).
You are suggesting to do it with IGV ? How ?
Forum: Bioinformatics 10-10-2016, 05:58 AM
Replies: 7
Views: 6,438
Posted By StephaniePi83
bamcount is not doing exactly what i'm asking, i...

bamcount is not doing exactly what i'm asking, i don't want readcounts for each base at each position.
I want the occurence of each tri-nucleotide at this specific site.
For example :
ACA = 5...
Forum: Bioinformatics 10-10-2016, 05:49 AM
Replies: 7
Views: 6,438
Posted By StephaniePi83
Thanks for your answer. Which command from...

Thanks for your answer.
Which command from bedtools ?
What is bamcount ?
Forum: Bioinformatics 10-10-2016, 05:28 AM
Replies: 7
Views: 6,438
Posted By StephaniePi83
Extract reads sequence based on position from bam file

Dear all,
I'm trying to recover reads sequences from specific region in bam file.
Reads were align using bowtie2.

I have reads align to one specific sequence and I would like to get sequences...
Forum: Bioinformatics 10-03-2013, 01:00 AM
Replies: 2
Views: 2,096
Posted By StephaniePi83
Hi Kennels, I'm not sure to well understand,...

Hi Kennels,
I'm not sure to well understand, what is the x-axis of the plot ? [0,25,50, ...] ?
There is redundancy no ? I mean, small RNA that have been counted in the windows [0,250] will also be...
Forum: Bioinformatics 10-02-2013, 08:55 AM
Replies: 2
Views: 2,096
Posted By StephaniePi83
plotting small RNA using window size - step size

Dear all,
I'm analyzing small RNA seq data.
I have the genomic coordinates of some elements (called cluster) on the genome.
I have to make some graph, representing the density of small RNA...
Forum: Bioinformatics 06-05-2013, 02:26 AM
Replies: 0
Views: 1,162
Posted By StephaniePi83
Novoalign and mismatches

Dear all,

I'am analyzing small RNA seq data (23-30 nt long RNA) and I need to map them allowing up to 4 mismatches.
I decided to use novoalign.

I take a read as an example, and i try to map...
Forum: Bioinformatics 04-03-2013, 12:48 AM
Replies: 1
Views: 1,582
Posted By StephaniePi83
Hi Ami, did you find a tool able to do this ?...

Hi Ami,
did you find a tool able to do this ? I have the same thing to do !
Thanks.
Forum: Bioinformatics 12-14-2012, 07:47 AM
Replies: 9
Views: 7,714
Posted By StephaniePi83
I re opened this thread because i have a similar...

I re opened this thread because i have a similar problem.
I have family of sequence sharing the same "motif" as in my example below :

I would like to get the smallest sequence sharing the motif,...
Forum: Bioinformatics 09-11-2012, 07:49 AM
Replies: 14
Views: 10,509
Posted By StephaniePi83
how to filter low quality reads ?

Dear all,
I read a paper in which they analyze small RNA seq data.
In a first step, they filter Low quality reads.
I know that we can use FASTQC in order to evaluate the quality of RNAseq data,...
Forum: Bioinformatics 09-06-2012, 12:30 AM
Replies: 3
Views: 2,428
Posted By StephaniePi83
I email the author. There was an issue with the...

I email the author. There was an issue with the program that didn't tricker the 5'/3' removal. He gives me the latest version with the fix !
Forum: Bioinformatics 09-05-2012, 07:42 AM
Replies: 3
Views: 2,428
Posted By StephaniePi83
Hi SES, I already try this; i think i'll email...

Hi SES,
I already try this; i think i'll email to the author as you suggest me :)
Forum: Bioinformatics 09-04-2012, 07:19 AM
Replies: 9
Views: 7,714
Posted By StephaniePi83
Yes i tested the script but it's really time...

Yes i tested the script but it's really time consuming for my dataset; it is running since more than 24 hours ...
Forum: Bioinformatics 09-04-2012, 06:01 AM
Replies: 3
Views: 2,428
Posted By StephaniePi83
PRINSEQ -derep option

Hi,
i would like to remove sequences that are identical with the 5' or 3' end of a longer sequence.
Here is an example of what i would like to do :
INPUT :
>pi1
AAAAAAAAAATTAAGGGCCAGCTGA
>pi12...
Forum: Bioinformatics 09-04-2012, 04:27 AM
Replies: 9
Views: 7,714
Posted By StephaniePi83
I re open this thread because i solved the...

I re open this thread because i solved the problem with the script bellow, but now, i have bigger file and it's time consuming.
I try to solve my problem with PRINSEQ, with the following comand...
Forum: Bioinformatics 09-04-2012, 01:49 AM
Replies: 10
Views: 2,169
Posted By StephaniePi83
Hi kopi-o, This is what i was thinking ! it map...

Hi kopi-o,
This is what i was thinking ! it map to all transcript of the same gene on transcriptome, and some reads will map to exon-exon juction that are not present on the genome.
Forum: Bioinformatics 09-04-2012, 12:55 AM
Replies: 10
Views: 2,169
Posted By StephaniePi83
Hi Paul, I didn't do this analysis neither the...

Hi Paul,
I didn't do this analysis neither the statistical analysis. My supervisor send our data to a person who did a pipeline to analyse iclip data (he did all bioinformatic analysis in the paper...
Forum: Bioinformatics 08-31-2012, 12:10 AM
Replies: 10
Views: 2,169
Posted By StephaniePi83
After removing adapter from my reads, i mapped...

After removing adapter from my reads, i mapped all read on the genome allowing up to 2 mismatches with bowtie. I translate bowtie output file to bed file; then i use Bedtools (intersectBed function)...
Forum: Bioinformatics 08-30-2012, 03:48 AM
Replies: 10
Views: 2,169
Posted By StephaniePi83
Hi paulsydney, we haven't published yet. Some...

Hi paulsydney,
we haven't published yet.
Some paper help me :
http://www.ncbi.nlm.nih.gov.gate1.inist.fr/pubmed/21048981
http://www.ncbi.nlm.nih.gov.gate1.inist.fr/pubmed/20601959...
Forum: Bioinformatics 08-07-2012, 12:58 AM
Replies: 10
Views: 2,169
Posted By StephaniePi83
Unique mapper on genome - multi mapper on transcriptome

Hi everybody,
I'm analyzing iCLIP data (technique to study protein-RNA interactions on a genome-wide scale). I have two populations bound by the protein of interest - small RNA and mRNA.
I take all...
Forum: Bioinformatics 07-09-2012, 02:38 AM
Replies: 26
Views: 7,170
Posted By StephaniePi83
Ok so i don't understand ... sorry ...

Ok so i don't understand ... sorry ...
Forum: Bioinformatics 07-09-2012, 02:28 AM
Replies: 26
Views: 7,170
Posted By StephaniePi83
i think it's : export PATH=$PATH:/path to...

i think it's :
export PATH=$PATH:/path to cutadapt repertory
Forum: Bioinformatics 07-09-2012, 02:20 AM
Replies: 26
Views: 7,170
Posted By StephaniePi83
So i don't know, i has worked for me even with...

So i don't know, i has worked for me even with the ELF class error ...
Do you add cutadapt to your path ?
Forum: Bioinformatics 07-09-2012, 02:17 AM
Replies: 26
Views: 7,170
Posted By StephaniePi83
And did you do "python setup.py build_ext -i"...

And did you do "python setup.py build_ext -i" after ?
Forum: Bioinformatics 07-09-2012, 02:15 AM
Replies: 26
Views: 7,170
Posted By StephaniePi83
Have you done : apt-get install python-dev ?

Have you done :
apt-get install python-dev ?
Showing results 1 to 25 of 52
Page 1 of 3 1 23

 


All times are GMT -8. The time now is 08:02 AM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO