SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read


Showing results 1 to 19 of 19
Search took 0.00 seconds. Search: Posts Made By: garethboy
Forum: Bioinformatics 08-28-2015, 12:51 PM
Replies: 0
Views: 1,118
Posted By garethboy
Base modification - Knowing the modified bases fall on coding or non-coding sequences

Hi,

I have done a bacterial genome sequencing using PacBio SMRT Sequencing, and I have done the assembly, checking its circularity followed by performing base modification analysis. I have...
Forum: Bioinformatics 04-09-2015, 06:58 AM
Replies: 3
Views: 1,988
Posted By garethboy
dear all, thanks. it is very useful. :-)

dear all, thanks. it is very useful. :-)
Forum: Bioinformatics 04-07-2015, 06:18 PM
Replies: 3
Views: 1,988
Posted By garethboy
Adding count number at the end of header in a fasta file

Hi there. I would like to add count number at the end of the head, from this:

>ECOLI
ACTGCGTAGTCGTACTATGCAACACACGTGTGTATGCT
>ECOLI
ACGTTAGTTTCGCGTAGTCGTATGCTACGATCGTAGCA
>ECOLI...
Forum: Bioinformatics 02-04-2014, 12:50 AM
Replies: 2
Views: 2,040
Posted By garethboy
How to do annotation after gene prediction?

Dear all,

I am pretty new in bioinformatics. I want to ask, after I perform gene prediction using PRODIGAL, I got the following:


>final_001_R1_00001 # 2 # 898 # 1 #...
Forum: Bioinformatics 01-15-2014, 05:36 PM
Replies: 2
Views: 1,238
Posted By garethboy
I am doing that, but investigating 18 genes from...

I am doing that, but investigating 18 genes from 62 bactertial genomes using MEGA can be pretty slow. Wonder is that any software which I can use to speed up the process. :-)
Forum: Bioinformatics 01-14-2014, 08:04 PM
Replies: 2
Views: 1,238
Posted By garethboy
Seaching for mutation of a single gene from numerous genomes

Hi all,

I am pretty new in bioinformatics and I need help for one of my project. I am currently studying quite a few of genes from 50+ genomes. The objective is to investigate the mutation...
Forum: Bioinformatics 01-06-2014, 09:02 PM
Replies: 9
Views: 10,236
Posted By garethboy
thank you dariober and dpryan. it works. :-)

thank you dariober and dpryan. it works. :-)
Forum: Bioinformatics 01-06-2014, 02:40 AM
Replies: 9
Views: 10,236
Posted By garethboy
Hi, thank you for the help. The sequences in the...

Hi, thank you for the help. The sequences in the original file (foo.fa in your reply) already in a linearized format.

After trying out the given command, the output is as following :-(
...
Forum: Bioinformatics 01-06-2014, 12:54 AM
Replies: 0
Views: 946
Posted By garethboy
Smile Mutation detection at the nucleotide and amino acid level for genes

Hi all,

I am currently studying quite a few of genes from several genomes. The objective is to investigate the mutation presence in the gene. I want to know which nucleotide (e.g. G152A, C1854G)...
Forum: Bioinformatics 01-06-2014, 12:46 AM
Replies: 9
Views: 10,236
Posted By garethboy
Sorting of fasta file according to gene name in alphabetical order

Hi all,

I am kinda new in bioinformatics. I have a question regarding sort of data, hope you all can guide me.:)

I have a single fasta file as follow:

>final_100_00001 hypothetical protein...
Forum: Bioinformatics 12-13-2013, 01:28 AM
Replies: 3
Views: 1,760
Posted By garethboy
thanks to both of you guys. Got my problem...

thanks to both of you guys. Got my problem solved. =)
Forum: Bioinformatics 12-13-2013, 12:43 AM
Replies: 3
Views: 1,760
Posted By garethboy
How to extract out a section of nucleotide sequence from the entire genome

Hi all,

In a single contig of ~6 Mbp, I would like to extract out the sequence from nucleotide #N1 to #N2 (e.g. nucleotide number 501 to 12,399). May I know how am I going to do this?

I am very...
Forum: Bioinformatics 09-27-2013, 02:27 AM
Replies: 9
Views: 1,679
Posted By garethboy
Thank you everybody. I have done my task. =)

Thank you everybody. I have done my task. =)
Forum: Bioinformatics 09-27-2013, 12:03 AM
Replies: 9
Views: 1,679
Posted By garethboy
Running is UNIX

Running is UNIX
Forum: Bioinformatics 09-26-2013, 11:32 PM
Replies: 9
Views: 1,679
Posted By garethboy
Thanks. I am pretty weak in Perl. Do you have any...

Thanks. I am pretty weak in Perl. Do you have any idea using AWK to do this?
Forum: Bioinformatics 09-26-2013, 11:31 PM
Replies: 9
Views: 1,679
Posted By garethboy
Anyone know how to use AWK to do this task?

Anyone know how to use AWK to do this task?
Forum: Bioinformatics 09-26-2013, 10:29 PM
Replies: 9
Views: 1,679
Posted By garethboy
problem with adding numerical sequence at the end of line

Hi,

Anyone has any idea how to get this:

>no_name
TATGCATCGATGCACATATGCTAGTGCGCTAGTGTCGAGGCTAGCTACG
>no_name
GACGTACGTAGCATGCATGCATGCGTAGCTGTAGCTAGC
>no_name...
Forum: Bioinformatics 09-07-2012, 09:27 PM
Replies: 4
Views: 1,664
Posted By garethboy
How to do genome-genome comparison

Besides Artemis, what are the softwares that can perform (1-to-1 or 1-to-many) genome-to-genome(s) comparison? Preferable the results presented in ring form, or with a good visuulization method.
...
Forum: Bioinformatics 09-07-2012, 09:20 PM
Replies: 0
Views: 1,889
Posted By garethboy
metabolic pathway analysis (bacteria) -What software to use?

Hi all. I am pretty new in bioinformatics. Currently I am working on two projects which I need to come out with a map or pathway map, which I have no idea what softwares to use. Whole genome...
Showing results 1 to 19 of 19

 


All times are GMT -8. The time now is 12:50 AM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO