SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read


Page 1 of 6 1 23 Last »
Showing results 1 to 25 of 140
Search took 0.01 seconds. Search: Posts Made By: gsgs
Forum: General 08-29-2017, 12:51 AM
Replies: 5
Views: 3,322
Posted By gsgs
I found it here: ...

I found it here:

https://www.researchgate.net/figure/230586432_fig1_HapZipper-compression-diagram-provided-a-dbSNP-database-Phased-haplotypes-are-compared

"HapZipper" , a paper from 2012, but...
Forum: General 02-27-2016, 01:56 AM
Replies: 5
Views: 2,182
Posted By gsgs
... or at least have an option to combine them...

... or at least have an option to combine them easily.
Files > 4GB could be expanded into multiple files <4GB

7zip often gives much better compression rates than gzip, so why does genbank use...
Forum: Bioinformatics 01-10-2016, 12:23 AM
Replies: 2
Views: 1,294
Posted By gsgs
mathematically speaking, suppose you have...

mathematically speaking,

suppose you have the two mappings a:{1,..,n}-->{A,C,G,T} and b:{1,..,m}-->{A,C,G,T}
representing the two genomes.

pick L (e.g. L=16) and compute
f:{1,..,n-L}-->{0,1}...
Forum: Bioinformatics 01-06-2016, 08:55 AM
Replies: 6
Views: 3,557
Posted By gsgs
x=genetic distance from my genome , interval,...

x=genetic distance from my genome , interval, maybe logarithmic
y(x)=number of organisms in the database with that distance

where to find that, how is it called ?
Forum: General 12-24-2015, 12:52 AM
Replies: 3
Views: 1,369
Posted By gsgs
just put it on some website and take care that it...

just put it on some website and take care that it will be found if someone
types the suitable keywords into a search engine.

Suppose, you wanted to find the data of some similar species,
for...
Forum: Bioinformatics 12-22-2015, 10:52 PM
Replies: 2
Views: 1,320
Posted By gsgs
reference genome could be the one with fewest...

reference genome could be the one with fewest differences
to the others (in average, or the sum).
Or at each position you could take the nucleotid that occurs most often.

Getting all the...
Forum: Bioinformatics 12-22-2015, 09:09 AM
Replies: 6
Views: 2,309
Posted By gsgs
he wants to extract from the genbank records...

he wants to extract from the genbank records (files *.gbk , *.gb ?) not only the amino-acid sequences
of the genes, as they are typically in those records, but also the corresponding nucleotides.
...
Forum: Bioinformatics 12-18-2015, 09:48 PM
Replies: 6
Views: 2,309
Posted By gsgs
find appearances of a certain subsequence in the...

find appearances of a certain subsequence in the long sequences of the file and extract the
next xxx bytes starting at that position (or some yyy bytes before or after it)

would that do it ?
Forum: Bioinformatics 12-18-2015, 09:28 PM
Replies: 38
Views: 8,483
Posted By gsgs
only those sequences with a "-" in the name ? ...

only those sequences with a "-" in the name ?

filtentr original 1 - > k1

[filters sequences (including name-lines) with - in the first entry]

names k1 5 5 > result
[only the raw sequence...
Forum: Literature Watch 12-18-2015, 11:58 AM
Replies: 1
Views: 5,861
Posted By gsgs
In general, most conference participants were...

In general, most conference participants were supportive “in principle” of a
collaborative, international effort to accelerate the transition to open access, although a
number of concerns were...
Forum: Bioinformatics 12-18-2015, 10:30 AM
Replies: 6
Views: 2,309
Posted By gsgs
I can probably do it in windows/dos , you have...

I can probably do it in windows/dos , you have the position of the genes ?
fasta file ?
Or you send the file I send the result ?
or part of it, to see/test it and I send the program
Forum: Bioinformatics 12-18-2015, 10:24 AM
Replies: 5
Views: 8,498
Posted By gsgs
get multiple external 3TB HDs and copy between...

get multiple external 3TB HDs and copy between them
Linux,Windows, whatever

they are so cheap meanwhile
Forum: Bioinformatics 12-18-2015, 10:14 AM
Replies: 38
Views: 8,483
Posted By gsgs
I usually write a small basic program for such...

I usually write a small basic program for such problems.

post/send the file, I send the result ?
Forum: General 12-18-2015, 10:04 AM
Replies: 3
Views: 2,109
Posted By gsgs
such a map : ...

such a map :

http://magictour.free.fr/seq/mitogi3.GIF

?
Forum: Bioinformatics 12-12-2015, 01:44 AM
Replies: 19
Views: 3,198
Posted By gsgs
http://www.biomedcentral.com/1471-2105/14/243 ...

http://www.biomedcentral.com/1471-2105/14/243
We release 4273π, an operating system image for Raspberry Pi based on Raspbian Linux
...
central GNU/Linux server on the campus and allow students to...
Forum: Bioinformatics 12-11-2015, 12:51 AM
Replies: 11
Views: 1,815
Posted By gsgs
TTTACATGAAACCCAAACATGTTAGAGTGTGGTGCCCACGAGCCCC ...

TTTACATGAAACCCAAACATGTTAGAGTGTGGTGCCCACGAGCCCC
,-3.nuc, JX514942, Human enterovirus C116


>test1 revertf
TTTACATGAAACCCAAACATGTTAGAGTGTGGTGCCCACGAGCCCC

>test1 revertf
YMKPKHVRVWCPRA-
Forum: Bioinformatics 12-11-2015, 12:34 AM
Replies: 11
Views: 1,815
Posted By gsgs
I took the opportunity to update my virus...

I took the opportunity to update my virus database from genbank...
I'm not sure yet what virus it could be
probably none of the 3 big HIV,Influenza,Hepatitis

maybe the amino-acid sequence of...
Forum: Bioinformatics 12-10-2015, 11:37 PM
Replies: 11
Views: 1,815
Posted By gsgs
can you also post the nucleotides-axcerpt

can you also post the nucleotides-axcerpt
Forum: Bioinformatics 12-10-2015, 10:15 PM
Replies: 19
Views: 3,198
Posted By gsgs
the first download of bio-linux failed, I have no...

the first download of bio-linux failed, I have no resulting file.
The 2nd download produced a file of exactly 2^31=2147483316 bytes
so I wonder whether that is some error with my system or browser...
Forum: Bioinformatics 12-10-2015, 09:56 PM
Replies: 11
Views: 1,815
Posted By gsgs
can you post or upload an excerpt of the sequence...

can you post or upload an excerpt of the sequence ?

even if you "construct" a sequence with low protein similarity,
with 5% nonmatching nucleotides you can only get 15%
nonmatching amino acids
Forum: Bioinformatics 12-10-2015, 12:43 PM
Replies: 19
Views: 3,198
Posted By gsgs
that was a Dell ......Alternate... or such,...

that was a Dell ......Alternate... or such, bought some years ago. , Windows was on it,
but no longer runs. Afterwards you always know better ...
Ok, bio-linux sounds good. Maybe it's even the...
Forum: Bioinformatics 12-10-2015, 05:42 AM
Replies: 19
Views: 3,198
Posted By gsgs
command line would be ok for me, I'm using it in...

command line would be ok for me, I'm using it in DOS (windows-cmd)
I'm not sure whether that desktop environment is usually easier and should be recommended
for bio-software. But I'm a...
Forum: Bioinformatics 12-10-2015, 05:26 AM
Replies: 19
Views: 3,198
Posted By gsgs
I can't be the only one with such problems ?! ...

I can't be the only one with such problems ?!
IMO it's of basic importance for using bio-software.

I'm trying to get the whole process easier, including compiling,
compatibility ,
Forum: Bioinformatics 12-10-2015, 05:11 AM
Replies: 19
Views: 3,198
Posted By gsgs
thanks for the replies above. (I didn't get an...

thanks for the replies above. (I didn't get an email about that, as usual)
GenoMax,
I don't know about Java. Also, I can't entirely switch to Linux, I still need my DOS/Windows tools,
so I have to...
Forum: Bioinformatics 12-10-2015, 04:55 AM
Replies: 19
Views: 3,198
Posted By gsgs
ok, I spent another 2h to figure out linux ... ...

ok, I spent another 2h to figure out linux ...
The knoppix actually did boot before just that I didn't realize it had finished booting.
I had interpreted the screen as some "booting art".
Some...
Showing results 1 to 25 of 140
Page 1 of 6 1 23 Last »

 


All times are GMT -8. The time now is 01:13 PM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO