SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 21 of 21
Search took 0.00 seconds.
Search: Posts Made By: aushev
Forum: Bioinformatics 05-08-2019, 07:02 AM
Replies: 2
Views: 1,114
Posted By aushev
Colin, thanks a lot for your input! ...

Colin, thanks a lot for your input!
(Unfortunately for now I had to switch to STAR because it's hard to get help for BBmap questions while STAR's author is very responsive and helpful)
Forum: Bioinformatics 04-01-2019, 01:04 AM
Replies: 2
Views: 1,114
Posted By aushev
Wrong mapping with BBmap default parameters

I performed mapping for my RNA-seq data (150 bp reads) with BBMap, just the default parameters (the only special parameter set was low memory):
bbmap.sh ref=gencode.v29.transcripts.fa...
Forum: Bioinformatics 03-29-2019, 07:44 AM
Replies: 678
Views: 184,567
Posted By aushev
I'm wondering if anyone tried to apply...

I'm wondering if anyone tried to apply callvariants.sh to RNA-seq data. When I tried to use it with my bam file, it found about 140,000 variants - but all of them are homozygous which is obviously...
Forum: Bioinformatics 02-25-2019, 06:32 PM
Replies: 331
Views: 129,005
Posted By aushev
sorry for another dummy question, but I really...

sorry for another dummy question, but I really want to understand how bbduk works and currently I'm having troubles with that... Below I list example of 11 reads containing adapter sequence which I...
Forum: Bioinformatics 02-25-2019, 05:14 PM
Replies: 331
Views: 129,005
Posted By aushev
yes, that's what I wanted - but I just wanted...

yes, that's what I wanted - but I just wanted also to understand what is the difference between bbduk and bbsplit for this purpose.
Forum: Bioinformatics 02-25-2019, 02:30 PM
Replies: 331
Views: 129,005
Posted By aushev
Thank you @GenoMax! What would be the main...

Thank you @GenoMax!
What would be the main advantage of using bbsplit instead of bbduk? As I understand, BBSplit internally uses BBMap, unlike BBDuk - but what would it practically mean? In my...
Forum: Bioinformatics 02-25-2019, 12:01 PM
Replies: 331
Views: 129,005
Posted By aushev
Hello, I was trying to filter out rRNA reads...

Hello,
I was trying to filter out rRNA reads using the command like this:

where ribokmers.fa.gz is taken from Brian's googledrive link posted at https://www.biostars.org/p/159959/
I noticed...
Forum: Sample Prep / Library Generation 05-12-2011, 04:50 AM
Replies: 6
Views: 3,711
Posted By aushev
quoting the wiki...

quoting the wiki (http://en.wikipedia.org/wiki/Auto-defrost#Disadvantages), "In laboratories, self-defrosting freezers must not be used to store certain delicate reagents such as enzymes, because the...
Forum: Sample Prep / Library Generation 05-10-2011, 02:05 AM
Replies: 8
Views: 5,124
Posted By aushev
I will be very thankful to hear any news about...

I will be very thankful to hear any news about your experience on deep sequencing of plasma miRNA as I will probably try to do the same (also on SOLiD) in future.

Good luck and all the best for...
Forum: Sample Prep / Library Generation 05-08-2011, 10:18 AM
Replies: 8
Views: 5,124
Posted By aushev
We had the final concentration similar to yours....

We had the final concentration similar to yours. In some papers, authors claim much higher yield but I have an impression that it is just due to wrong S/F quantification.
I never tried to make...
Forum: SOLiD 05-06-2011, 04:56 AM
Replies: 36
Sticky: SOLiD Adapters
Views: 40,611
Posted By aushev
Sorry, I didn't make it clear - I meant that TGGC...

Sorry, I didn't make it clear - I meant that TGGC is only in internal adapter, not in this one. Adaptors from the ligation mix are marked in red/magenta.
Forum: SOLiD 05-05-2011, 09:02 PM
Replies: 36
Sticky: SOLiD Adapters
Views: 40,611
Posted By aushev
thanks for cautioning, I totally agree, that's...

thanks for cautioning, I totally agree, that's why I indicated the source of data.
Forum: SOLiD 05-05-2011, 03:28 PM
Replies: 36
Sticky: SOLiD Adapters
Views: 40,611
Posted By aushev
And this is how they can be aligned to known P1...

And this is how they can be aligned to known P1 and internal adapters mentioned in post #2:

P1 Adapter:
1) 5' -------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT
2) 3' -----TTGG TGATGCGGAGGCG...
Forum: SOLiD 05-05-2011, 03:06 PM
Replies: 36
Sticky: SOLiD Adapters
Views: 40,611
Posted By aushev
ok, finally I found by myself :) according to...

ok, finally I found by myself :)
according to published patent 20100279305, adaptor oligo mix contains
1) 5'-CCUCUCUAUGGGCAGUCGGUGAU (3.1 μM)
2) 5'-NNNNNNATCACCGACTGCCCATAGAGAGG (6.1 μM)
3)...
Forum: SOLiD 05-05-2011, 11:43 AM
Replies: 36
Sticky: SOLiD Adapters
Views: 40,611
Posted By aushev
well, for the moment I am working with microRNA,...

well, for the moment I am working with microRNA, i.e. don't care about polyA.
(to tell the full story, I am trying to understand if there is a way to make miRNA->cDNA library compatible for both...
Forum: SOLiD 05-05-2011, 08:57 AM
Replies: 36
Sticky: SOLiD Adapters
Views: 40,611
Posted By aushev
What about adaptors used for RNA ligation in...

What about adaptors used for RNA ligation in "Total RNA-Seq" kit? if I am not wrong, their sequenced are not disclosed here?
Thanks in advance.
Forum: Ion Torrent 05-05-2011, 05:49 AM
Replies: 25
Views: 23,407
Posted By aushev
thanks for the answer, but I am not the customer...

thanks for the answer, but I am not the customer yet - I simply would like to know more in advance.
(To tell the truth, I see absolutely no sense in this kind of limitation of access to User Guides,...
Forum: Ion Torrent 05-05-2011, 05:03 AM
Replies: 25
Views: 23,407
Posted By aushev
I tried to register in Ion Community, but I still...

I tried to register in Ion Community, but I still don't see anything useful. In the section "Documents", there is only 3 pdf available, with only some general information. Is there anything more...
Forum: The Pipeline 11-25-2010, 10:42 AM
Replies: 4
Views: 6,524
Posted By aushev
ok, with numbers it became more clear. Thank you...

ok, with numbers it became more clear. Thank you for explanation!
Forum: The Pipeline 11-24-2010, 11:47 AM
Replies: 4
Views: 6,524
Posted By aushev
Thanks for answer! But can we really disregard...

Thanks for answer!
But can we really disregard the price? I mean, if single run is many times cheaper, you can simply put more portions to increase the coverage...
Forum: The Pipeline 11-19-2010, 09:18 AM
Replies: 4
Views: 6,524
Posted By aushev
Can Ion Torrent be useful for microRNA sequencing?

Dear colleagues,
what do you think about applicability of Ion Torrent for miRNA profiling? They promise "Thousands to Millions of moderate reads per sample". "Moderate reads" is even excessive here,...
Showing results 1 to 21 of 21

 


All times are GMT -8. The time now is 07:20 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO