SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 14 of 14
Search took 0.00 seconds.
Search: Posts Made By: Johnwang
Forum: Bioinformatics 02-17-2017, 07:07 AM
Replies: 13
Views: 4,265
Posted By Johnwang
thanks.

I will do that. :)
Forum: Bioinformatics 02-16-2017, 02:46 PM
Replies: 13
Views: 4,265
Posted By Johnwang
Forum: Bioinformatics 02-16-2017, 01:46 PM
Replies: 13
Views: 4,265
Posted By Johnwang
example

>Sg01_138835_A_G
TGCGAAGTATGCCACCAACATGTTTCACCGCATAACCTTGATCACCTTGGACATTCTGCCACAAGCAGACGACGAGTTCCTCAGAAAATTCATGGACAAATTTGGGCGCACGACCATCTA ...
Forum: Bioinformatics 02-16-2017, 01:33 PM
Replies: 13
Views: 4,265
Posted By Johnwang
more specifics

Would you please give me more details ? Thanks.:)
Forum: Illumina/Solexa 02-16-2017, 12:09 PM
Replies: 10
Views: 2,957
Posted By Johnwang
new sequencing primers

:)Hi Yepler, the run with new sequencing primers worked perfectly. Thanks.
Forum: Bioinformatics 02-16-2017, 12:04 PM
Replies: 13
Views: 4,265
Posted By Johnwang
Retrieve mapped reads to certain regions (eg. between 120-140 in a gene)?

I have my own unannotated reference data base. With it, the reads were mapped with Bowtie, now I need to retrieve all reads which mapped to certain region between 120-140 nt/each gene, how can I do...
Forum: Illumina/Solexa 01-09-2017, 09:03 AM
Replies: 10
Views: 2,957
Posted By Johnwang
my sequencing primer

Hi Yepler,
Here are my sequencing primers, would you please take a look and tell me if you have any suggestion. Thank you.

CTACCGTCGGAT+CGTG+CGTGT
ACGAGATCCGTAATC+GGGAA+GC+TGAAG
Forum: Illumina/Solexa 01-09-2017, 08:23 AM
Replies: 10
Views: 2,957
Posted By Johnwang
Hi Yepler, Many thanks for your inform and...

Hi Yepler,
Many thanks for your inform and suggestions. By the way, quick question for LNA oligos, is Standard Desalting good enough ? or have go with HPLC purity.

:)
Forum: Illumina/Solexa 01-06-2017, 07:27 AM
Replies: 10
Views: 2,957
Posted By Johnwang
Hi Yepler, thanks for your response with...

Hi Yepler, thanks for your response with suggestions. As you mentioned, my Tm is pretty low when you checked it on IDT oligo analyzer. I looked it on exiqon, it is close to 70C. I can do LNA to...
Forum: Illumina/Solexa 01-05-2017, 08:17 AM
Replies: 27
Views: 4,871
Posted By Johnwang
same issue with our run

Hi Yepler,
Great point!! It will be great if you provide more details on your custom primers ? such as length and Tm. By the way, did you use IDT web based tool to calculate your Tm ?

Thank you.
Forum: Illumina/Solexa 09-23-2016, 07:11 AM
Replies: 10
Views: 2,957
Posted By Johnwang
Thank you. Here are primers used for MIP...

Thank you. Here are primers used for MIP amplification and NextSeq. :)

Example of amplicon amplified with P7 and P5 in primers respectively:
...
Forum: Sample Prep / Library Generation 09-02-2016, 08:32 AM
Replies: 7
Views: 4,437
Posted By Johnwang
Extract RNA from single pollen

Hi guys, is there any good RNA extraction method for single pollen ? Thanks.;)
Forum: Illumina/Solexa 09-02-2016, 07:40 AM
Replies: 10
Views: 2,957
Posted By Johnwang
low clustering and bad sequencing primer efficiency on NextSeq 500

I got low clustering and very bad sequencing primer efficiency on NextSeq 500 run in my MIP project. The sequencing primers (read1, read2 and two index primers) are customized. We have tried either...
Forum: Introductions 06-20-2016, 03:04 PM
Replies: 1
new
Views: 533
Posted By Johnwang
new

Hell:), this John, new in SEQ.
Showing results 1 to 14 of 14

 


All times are GMT -8. The time now is 02:41 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO