SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read

Page 1 of 20 1 2311 Last »
Showing results 1 to 25 of 500
Search took 0.14 seconds. Search: Posts Made By: pmiguel
Forum: Illumina/Solexa 12-15-2021, 08:32 AM
Replies: 6
Views: 2,247
Posted By pmiguel
I am asking because normally if I saw odd results...

I am asking because normally if I saw odd results from a run -- where there were no PF% calculated at all -- I would check the images using SAV. If there were no images, but the run finished on the...
Forum: Illumina/Solexa 12-15-2021, 06:49 AM
Replies: 6
Views: 2,247
Posted By pmiguel
Are you getting the cluster density from SAV? If...

Are you getting the cluster density from SAV? If not, where?

--
Phillip
Forum: Illumina/Solexa 12-13-2021, 12:44 PM
Replies: 6
Views: 2,247
Posted By pmiguel
By "no % PF", do you mean, PF% was zero, or PF%...

By "no % PF", do you mean, PF% was zero, or PF% was not calculated? If the latter, then that is an issue independent of library quality. I have never seen this, but it sounds more like an issue with...
Forum: Sample Prep / Library Generation 02-06-2020, 08:52 AM
Replies: 21
Views: 10,152
Posted By pmiguel
Interesting. Appears to use a...

Interesting. Appears to use a strand-denaturation/hybridization-based normalization to remove/reduce concentrations of highly represented cDNAs. That is, enzymatic digestion of DNA/RNA duplexes that...
Forum: Sample Prep / Library Generation 12-22-2019, 09:49 AM
Replies: 20
Views: 16,361
Posted By pmiguel
Glad to help... -- Phillip

Glad to help...
--
Phillip
Forum: Bioinformatics 10-11-2019, 07:25 AM
Replies: 3
Views: 1,817
Posted By pmiguel
Don't you mean: for file in *.fastq.sam.bam ...

Don't you mean:

for file in *.fastq.sam.bam
do
mv $file ${file%.fastq.sam.bam}.txt
done

--
Phillip
Forum: Illumina/Solexa 09-30-2019, 05:34 AM
Replies: 2
Views: 2,005
Posted By pmiguel
[Note added after writing post: this exact same...

[Note added after writing post: this exact same question, using the same wording was posted previously:

http://seqanswers.com/forums/showthread.php?t=86749

Why?]

Right, you just put the...
Forum: Sample Prep / Library Generation 06-21-2019, 06:44 AM
Replies: 5
Views: 4,901
Posted By pmiguel
Old school method involved embedding cells in...

Old school method involved embedding cells in agarose and lysing/prepping the DNA in situ. Initially these were just little slabs of agarose. But later moved more to higher surface area collects of...
Forum: Bioinformatics 06-12-2019, 11:43 AM
Replies: 2
Views: 1,651
Posted By pmiguel
Looks more-or-less random to me. How many...

Looks more-or-less random to me. How many standard deviations from the mean number of hits/repeat are the high and low-hit repeat counts?

--
Phillip
Forum: Illumina/Solexa 05-07-2019, 12:01 PM
Replies: 2
Views: 2,163
Posted By pmiguel
Best method to add custom primer to MiSeq Illumina sequencing primers?

What pipette is recommended (or have you seen used) to pipette custom primer into the Illumina sequencing primer wells of a MiSeq? (See here...
Forum: Illumina/Solexa 04-18-2019, 08:35 AM
Replies: 1
Views: 1,601
Posted By pmiguel
Differential amplicon size effects on clustering across Illumina instruments

I would like to recommend to your attention a Bioarchive (pre-print) paper:

https://doi.org/10.1101/388108

entitled:
Measuring Illumina Size Bias Using REcount: A Novel Method for Highly...
Forum: Illumina/Solexa 03-25-2019, 07:56 AM
Replies: 1
Views: 1,119
Posted By pmiguel
The answer is: The sequence: ...

The answer is:

The sequence:
Oligonucleotide sequences©2017 Illumina,Inc. All rights reserved.

AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGTCCGA

is just the PCR primer and doesn't contain the...
Forum: Illumina/Solexa 03-22-2019, 08:10 AM
Replies: 1
Views: 1,119
Posted By pmiguel
Small RNA adapters skip first 5 bases of R1?

I've now seen a couple of sets of libraries with Illumina "small RNA" adapters that seem to somehow "skip" the first 5 bases of R1. This being being obvious only when comparing the forward and...
Forum: Illumina/Solexa 03-07-2019, 10:40 AM
Replies: 5
Views: 3,898
Posted By pmiguel
Seems like this recent change is more of a...

Seems like this recent change is more of a reversion to the original Illumina plan types. With a very low level coverage for people who pretty much do their own repairs (bronze) and the more standard...
Forum: Bioinformatics 03-01-2019, 06:21 AM
Replies: 4
Views: 2,087
Posted By pmiguel
"You have recently started working in a lab and...

"You have recently started working in a lab and have been assigned the following task:"

That was the first sentence of your homework question (or take home exam), right?

--
Phillip
Forum: Bioinformatics 03-01-2019, 02:53 AM
Replies: 4
Views: 2,087
Posted By pmiguel
Upon being given such a homework assignment, I...

Upon being given such a homework assignment, I would post it on appropriate web forums hoping to find someone gullible enough to save me from answering the question myself.

Wait, no! I would not...
Forum: Illumina/Solexa 01-17-2019, 12:04 PM
Replies: 1
Views: 1,237
Posted By pmiguel
First, we should legally sanctify this thread: ...

First, we should legally sanctify this thread:



What you would want to add on to the outside of your primers would be:

Index1 side
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

Index2 side
Forum: 454 Pyrosequencing 01-14-2019, 08:13 AM
Replies: 5
Views: 23,194
Posted By pmiguel
I wouldn't go that far! Cheap (no-agarose-gel)...

I wouldn't go that far! Cheap (no-agarose-gel) Illumina mate-pair libraries are still legitimate, if trailing-edge, technologies.

454 is *dead*, dead.

--
Phillip
Forum: 454 Pyrosequencing 01-14-2019, 07:06 AM
Replies: 5
Views: 23,194
Posted By pmiguel
See the OP. The 454 is obsolete. Reagents no...

See the OP. The 454 is obsolete. Reagents no longer available to run the instrument. Hard to get less "beginner friendly" than "dead".

--
Phillip
Forum: Illumina/Solexa 12-20-2018, 11:40 AM
Replies: 9
Views: 4,343
Posted By pmiguel
You are running non-UDI indexes on the NovaSeq?...

You are running non-UDI indexes on the NovaSeq? Are you not concerned about index swapping?

We demultiplex allowing 0 mismatches for all Illumina runs these days. So I haven't taken note of...
Forum: Illumina/Solexa 12-03-2018, 02:49 AM
Replies: 6
Views: 8,062
Posted By pmiguel
Impossible to guess what "much less" means in...

Impossible to guess what "much less" means in this context. The previous poster mentioned 100x less -- that is clearly an issue.

Anyway, you will want to contact Illumina technical support. That...
Forum: Illumina/Solexa 11-30-2018, 03:30 AM
Replies: 3
Views: 3,168
Posted By pmiguel
No reason why it would not be possible. Since you...

No reason why it would not be possible. Since you don't specify an organism, I presume you mean a mammal. So you want an average of 3 billion bases/sample. So that would be 1000 UDIs. Presuming you...
Forum: Sample Prep / Library Generation 11-26-2018, 06:40 AM
Replies: 4
Views: 1,613
Posted By pmiguel
Yes, please everyone switch to blue light...

Yes, please everyone switch to blue light illumination for preparative gels! We did so > 20 years ago. I'm just realizing that many labs (and new PI!) are unaware of the problems UV light damage to...
Forum: Illumina/Solexa 11-06-2018, 06:22 AM
Replies: 8
Views: 4,936
Posted By pmiguel
SAV 2.4.5 includes an "occupied count" and "%...

SAV 2.4.5 includes an "occupied count" and "% occupied" metric in the drop down list of the Flow Cell Chart pane of the Analysis tab.

--
Phillip
Forum: Illumina/Solexa 11-01-2018, 09:07 AM
Replies: 8
Views: 4,936
Posted By pmiguel
The new version of SAV has a metric "% occupancy"...

The new version of SAV has a metric "% occupancy" for each tile. You should check that.
It looks like you either had very low occupancy (very under-clustered) or very massive over-clustering....
Showing results 1 to 25 of 500
Page 1 of 20 1 2311 Last »

 

All times are GMT -8. The time now is 06:35 AM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2022, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO