SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 15 of 15
Search took 0.00 seconds.
Search: Posts Made By: satishg
Forum: Bioinformatics 08-25-2015, 12:02 PM
Replies: 2
Views: 1,336
Posted By satishg
Thanks ! I was able to install it locally. I will...

Thanks ! I was able to install it locally. I will explore it.
Forum: Bioinformatics 08-25-2015, 11:36 AM
Replies: 2
Views: 1,336
Posted By satishg
Smile Sorting Amino Acid Sequences

I have a a set of three fasta files with amino acid sequences. Can you suggest me scripts to separate out sequences that are common, and as well that are different among each of the three fasta files?
Forum: Bioinformatics 07-31-2015, 10:35 AM
Replies: 1
Views: 1,203
Posted By satishg
To make it clear, I want to create image files of...

To make it clear, I want to create image files of each chromosome indicating SNPs and INDELs at each location as provided in the vcf files.
Forum: Bioinformatics 07-31-2015, 08:28 AM
Replies: 1
Views: 1,203
Posted By satishg
Smile Mapping SNPs to Chromosomes

I have a reference genome (.fa) and its annotation (.gtf) files. I have sequenced both DNA and RNA from test sample and generated vcf files containing SNP and INDEL locations for each chromosome of...
Forum: Bioinformatics 07-06-2015, 12:52 PM
Replies: 9
Views: 1,466
Posted By satishg
Thanks ! It seems to be clearing out unpaired...

Thanks ! It seems to be clearing out unpaired reads. I used Trimmomatic to trim the reads, followed by running TransAbyss-Analyze. When I got the unpaired reads error, I processed the paired reads...
Forum: Bioinformatics 07-06-2015, 08:58 AM
Replies: 9
Views: 1,466
Posted By satishg
It does not return anything. What is that...

It does not return anything. What is that supposed to mean?
Forum: Bioinformatics 07-06-2015, 08:51 AM
Replies: 9
Views: 1,466
Posted By satishg
They show up: $ zgrep -A 3...

They show up:

$ zgrep -A 3 7:1101:10524:57301 RG11_NR_P3_R1.fq.gz
@FCC6B7TACXX:7:1101:10524:57301#/1
CCTCATGGATACCAAGCTTGAGGTTCTTTGAGAATGCCTCATAAAACTTGTTGTAATCTTCCTTGTTCTCTGCTATTTCAAAGAAGAG
+...
Forum: Bioinformatics 07-06-2015, 07:17 AM
Replies: 9
Views: 1,466
Posted By satishg
Thumbs down TranAbyss-Analyze Error

Although the paired reads were checked with two different scripts for unpaired reads before running TransAbyss-Analyze, an error saying "the paired-end accessions do not match" is output before...
Forum: Bioinformatics 08-27-2014, 07:30 AM
Replies: 2
Views: 1,218
Posted By satishg
BLAST+ How not to print 'NO Hits"

I have a small database compared to the input sequence file. Is there an option in blast+ to print out only the hits and not the ones that have no hit?
Forum: Bioinformatics 08-12-2014, 11:29 AM
Replies: 12
Views: 3,495
Posted By satishg
Finally.......it all looks good ! >1 ...

Finally.......it all looks good !

>1
APEGDARPRQSGHPACHELDAADRRQGEIPGVPERRLCDASL
>2
ADSGGRGGCRRRCGDLPAAALIRGRGDDTDRPVPARRRPGRVRRGAGGPATAAGRARGVDRRAGLRGRA
>3
NSVNPDVSQHSPERHFHTSEGTLC
>4...
Forum: Bioinformatics 08-12-2014, 09:58 AM
Replies: 12
Views: 3,495
Posted By satishg
Thanks ALL - I however have the issue with...

Thanks ALL - I however have the issue with numbering sequences in order; removed the line delimiter and finally have the output file as:

>1
APEGDARPRQSGHPACHELDAADRRQGEIPGVPERRLCDASL
>2...
Forum: Bioinformatics 08-12-2014, 07:23 AM
Replies: 12
Views: 3,495
Posted By satishg
Thanks dpryan - the third code works effectively...

Thanks dpryan - the third code works effectively but it skips numbers for a sequence following the one which has it on two lines; say sequence #5 has two lines for which the output would be >5...
Forum: Bioinformatics 08-12-2014, 06:42 AM
Replies: 12
Views: 3,495
Posted By satishg
GenoMax - that didn't do anything. The .bak file...

GenoMax - that didn't do anything. The .bak file has no numbers assigned and when I ran the awk command that was suggested it didn't make any changes or add numbers to the output file.

Thanks...
Forum: Bioinformatics 08-11-2014, 01:16 PM
Replies: 12
Views: 3,495
Posted By satishg
Thanks GenoMax. The output is as as follows: ...

Thanks GenoMax. The output is as as follows:

>1

>2
>APEGDARPRQSGHPACHELDAADRRQGEIPGVPERRLCDASL
>3

>4
>ADSGGRGGCRRRCGDLPAAALIRGRGDDTDRPVPARRRPGRVRRGAGGPATAAGRARGVDRRAGLRGRA
Forum: Bioinformatics 08-11-2014, 11:22 AM
Replies: 12
Views: 3,495
Posted By satishg
Fasta File Editing

I have a file with text as:

>APEGDARPRQSGHPACHELDAADRRQGEIPGVPERRLCDASL
>ADSGGRGGCRRRCGDLPAAALIRGRGDDTDRPVPARRRPGRVRRGAGGPATAAGRARGVDRRAGLRGRA
>NSVNPDVSQHSPERHFHTSEGTLC

I need to change it by...
Showing results 1 to 15 of 15

 


All times are GMT -8. The time now is 05:17 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO