SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 33
Search took 0.00 seconds.
Search: Posts Made By: shashankgupta
Forum: Bioinformatics 02-15-2017, 06:55 PM
Replies: 2
Views: 893
Posted By shashankgupta
I have tried above for loop, but its not working....

I have tried above for loop, but its not working.


The output I got looks like -

0
CCTACGGGTGGCTGCAGTGGGGAATTTTGG
0
ACTACGGGAGGCAGCAGGGGGGAATTTTGGACA
Forum: Bioinformatics 02-15-2017, 12:45 AM
Replies: 2
Views: 893
Posted By shashankgupta
rename mutiple fasta header for mutiple fasta files

Hi,

I have mutiple fasta file and I want to change the header, for this I am using -

awk '/^>/{print ">C1_" ++i; next}{print}' C1_pandaseq.fasta > C1_pandaseq_new.fasta

input fasta- ...
Forum: Bioinformatics 02-14-2017, 08:46 PM
Replies: 7
Views: 2,811
Posted By shashankgupta
Thank you for helping me. But, somehow it is...

Thank you for helping me.
But, somehow it is showing some error as shown below-

TrimmomaticPE: Started with arguments:
0*_R1_001.fastq.gz 0*_R2_001.fastq.gz 0_R1.trimmed_PE.fastq...
Forum: Bioinformatics 02-14-2017, 03:41 AM
Replies: 7
Views: 2,811
Posted By shashankgupta
Using trimmomatic on multiple paired-end read files

I need help to write a for loop to run Trimmomatic tool for quality trimming of paired end fastq files.
I need to write a for loop so that I can run an executable for all multiple files.

Input...
Forum: Bioinformatics 08-11-2015, 09:23 PM
Replies: 21
Views: 11,143
Posted By shashankgupta
Hi, i am trying to align 5 bacterial genome...

Hi,
i am trying to align 5 bacterial genome using Progressive MAUVE, i got the output, now i would like to create a phylogenetic tree for the alignement, so which software should i use for...
Forum: Bioinformatics 08-11-2015, 03:22 AM
Replies: 2
Views: 984
Posted By shashankgupta
RAST server annotation result to STAMP statistical software

Hi,
I have annotated the 5 bacterial genome using RAST server, can we take the output from RAST server and use it in a STAMP statistical software.

What i am trying to say is If we use MG-RAST...
Forum: Bioinformatics 05-21-2015, 09:48 PM
Replies: 1
Views: 542
Posted By shashankgupta
Protein sequence analysis

Hi,

I have a multiple protein sequence which looks like -

>gnl|TC-DB|198412035 1.A.70.1.3 PREDICTED: hypothetical protein [Ciona intestinalis]...
Forum: Bioinformatics 04-09-2015, 09:28 PM
Replies: 9
Views: 4,035
Posted By shashankgupta
I am also trying to do analysis for PAN/CORE...

I am also trying to do analysis for PAN/CORE genome, but the above mentioned software is for someone who have good hands in linux based system.

Is there a simple way where non-bioinformatician...
Forum: Bioinformatics 04-09-2015, 09:05 PM
Replies: 1
Views: 919
Posted By shashankgupta
PAN and CORE genome analysis

Hi,
I have an OTU biom file (obtained from Closed reference QIIME 1.8.0 v) contains 65 samples, I am trying to do analysis for PAN/CORE genome.
I have filtered out the taxonomy from the abundance...
Forum: Bioinformatics 03-03-2015, 09:16 PM
Replies: 0
Views: 519
Posted By shashankgupta
Augustus result interpretation

Hi,

I am new to augutus and i used Augustus for fungal genome analysis.

i used command :

augustus --species=human --UTR=on sequence.fasta > sequence_augustus.gff
Forum: Bioinformatics 02-21-2015, 07:38 AM
Replies: 1
Views: 1,168
Posted By shashankgupta
transcription factor binding site prediction software/server for Prokaryotic DNA

Hi,

I have a Prokaryotic DNA sequence (fasta file format), i would like to predict transcription factor binding site ( TFBS) and ribosomal binding sites (RBS).

Is there an eay software/server...
Forum: Bioinformatics 02-12-2015, 07:10 PM
Replies: 39
Views: 3,480
Posted By shashankgupta
gff (General Feature Format) obtained from...

gff (General Feature Format) obtained from AUGUSTUS.
is there any tool which do annotation
Forum: Bioinformatics 02-12-2015, 08:59 AM
Replies: 39
Views: 3,480
Posted By shashankgupta
I have a quick question, once i have predicted...

I have a quick question, once i have predicted the genes using AUGUTUS tool (i have now a output file in gff format) .

then how can i annotate the file, i mean to say the purpose of using these...
Forum: Bioinformatics 02-10-2015, 07:16 PM
Replies: 0
Views: 597
Posted By shashankgupta
CloVR for fungal genome

Hi,
i am new to CloVR, i am trying to use CloVR for fungal genome using ITS database.

i didn't find any protocol or tutorial like QIIME/Mothur have. Anyone have idea that once i have uploaded the...
Forum: Bioinformatics 02-09-2015, 03:15 AM
Replies: 39
Views: 3,480
Posted By shashankgupta
thanks.. i guess now i understand what to do...

thanks.. i guess now i understand what to do...
Forum: Bioinformatics 02-09-2015, 02:19 AM
Replies: 39
Views: 3,480
Posted By shashankgupta
in other system, mpich2 is also installed. ...

in other system, mpich2 is also installed.

steps:

Install MAKER. Download from http://www.yandell-lab.org

a. Unpack the MAKER tar file into the directory of your choice (i.e.
...
Forum: Bioinformatics 02-09-2015, 12:57 AM
Replies: 39
Views: 3,480
Posted By shashankgupta
i tried, i guess everything is installed, but...

i tried, i guess everything is installed, but one, i.e.

./Build mpich2

ERROR: Failed installing mpich2, now cleaning installation path...
You may need to install mpich2 manually.

[[email protected]
Forum: Bioinformatics 02-05-2015, 08:39 PM
Replies: 39
Views: 3,480
Posted By shashankgupta
i tried to install but i got many errors, which...

i tried to install but i got many errors, which is quit difficult for me to resolve (bcoz i am not bioinformatic/programmer).

Thats why i need help in that for installing
Forum: Bioinformatics 02-05-2015, 08:33 AM
Replies: 39
Views: 3,480
Posted By shashankgupta
I believe someone else could help

I believe someone else could help
Forum: Bioinformatics 02-05-2015, 06:52 AM
Replies: 39
Views: 3,480
Posted By shashankgupta
Hi, as you helped me to install AUGUSTUS, can you...

Hi, as you helped me to install AUGUSTUS, can you tell me as well how can i install MAKER (genome annotation tool) as well.

I really need to do this.
Forum: Bioinformatics 02-05-2015, 06:26 AM
Replies: 39
Views: 3,480
Posted By shashankgupta
miracle :) it works pretty good.. tooks hardly 20...

miracle :) it works pretty good.. tooks hardly 20 min. . Thanks !
I appreciate it.
Best !
Shashank
Forum: Bioinformatics 02-05-2015, 06:15 AM
Replies: 39
Views: 3,480
Posted By shashankgupta
i give it a try for latest version (3.0.3) in...

i give it a try for latest version (3.0.3) in ubuntu
Forum: Bioinformatics 02-05-2015, 01:54 AM
Replies: 39
Views: 3,480
Posted By shashankgupta
i undrstand the concept about the case...

i undrstand the concept about the case sensitivity.
when i used command

which augustus

no output from the command

i tried everything to make it install, please walk with me to install it.
Forum: Bioinformatics 02-04-2015, 08:22 PM
Replies: 39
Views: 3,480
Posted By shashankgupta
i tried in other system, and make command works...

i tried in other system, and make command works perfectly fine....

$PWD
/home/qiime/Desktop/augustus.2.5.5/config/

and then

export...
Forum: Bioinformatics 02-04-2015, 01:15 AM
Replies: 39
Views: 3,480
Posted By shashankgupta
indeed. i used the above command. when i...

indeed. i used the above command.

when i tried to use AUGUSTUS, i got an error

[[email protected] augustus.2.5.5]# augustus --species=SPECIES 454AllContigs.fna > output.gff
bash: augustus: command not...
Showing results 1 to 25 of 33

 


All times are GMT -8. The time now is 03:54 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO