SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 15 of 15
Search took 0.00 seconds.
Search: Posts Made By: khb
Forum: Bioinformatics 02-14-2011, 12:30 AM
Replies: 5
Views: 1,735
Posted By khb
Question Long peaks

Hi
I've done a chip-seq experiment, and used the program MACS. When I look at the peaks in UCSC genome browser, the peaks are very long, see pdf file for example from mitochondrial chromosome. Is...
Forum: Bioinformatics 02-07-2011, 02:58 AM
Replies: 3
Views: 1,367
Posted By khb
Of course. Thanks

Of course. Thanks
Forum: Bioinformatics 02-07-2011, 12:48 AM
Replies: 3
Views: 1,367
Posted By khb
Missing strand _peaks.bed

Hi
I've tried to analyze my data with MACS, and want the file _peaks.bed that MACS gives. Does anyone know how to know which strand each peak is on? The file only contains
chrom start stop name...
Forum: Bioinformatics 01-11-2011, 09:42 PM
Replies: 1
Views: 6,504
Posted By khb
Length exon, intron, promoter and intergenic regions in human genome

Hi
Does anyone know the distribution of exons, introns in the human genome? How many bp are there of exons and the number of bp of introns? Or does anyone have a good suggestion on how...
Forum: Bioinformatics 01-10-2011, 05:13 AM
Replies: 1
Views: 2,272
Posted By khb
Question MACS peaks.bed

Hi
I wounder how MACS score the peaks. When you run MACS you get a output peaks.bed, this file include chromosome, start, stop, peaknumber and a score. How does MACS create this score? Does the...
Forum: Bioinformatics 12-22-2010, 02:28 AM
Replies: 1
Views: 2,803
Posted By khb
Exclamation Human exon, intron and promotor bedfile

Hi
I have done a chip-seq analysis and got a file with name peaks.bed I want to investigate if the peaks are in the promotor, exon og intron of hg19. Does somebody know where to get the bedfiles of...
Forum: Bioinformatics 12-21-2010, 09:47 PM
Replies: 0
Views: 2,998
Posted By khb
Exons from UCSC (Refseq)

Hi
I've tried to get bed files for human exon, intron and promotor region. Used the http://genome.ucsc.edu/ Table browser and choosed track RefSeq genes.
Then I use intersectbed to see how many of...
Forum: Bioinformatics 12-19-2010, 09:37 AM
Replies: 2
Views: 1,390
Posted By khb
I used bowtie. Here is some of the output from...

I used bowtie.
Here is some of the output from bowtie
HWUSI-EAS1525_0005_FC:4:1:7582:8004#0/1 - chrM 313 CCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAAAAA ...
Forum: Bioinformatics 12-17-2010, 05:26 AM
Replies: 2
Views: 1,390
Posted By khb
Question MACS SAMfiles

Hi
I've used MACS to find peaks in a SAM file, and I got a line in the peaks.bed file in SAM with negative start (-98) so I cannot upload the file in UCSC genome browser.
chrM -98 4052...
Forum: Bioinformatics 12-16-2010, 04:22 AM
Replies: 1
Views: 15,888
Posted By khb
Question convert wig to bigwig

I've used MACS and got one wig file per chromosome. I want to make a bigwig file and used the manual on ucsc http://genome.ucsc.edu/goldenPath/help/bigWig.html.
1. Should I put the wig files...
Forum: Bioinformatics 12-16-2010, 01:05 AM
Replies: 11
Views: 4,142
Posted By khb
Thanks I think it's strange ; it doesn't...

Thanks


I think it's strange ; it doesn't seem like it is unique sequences.

The read length is 50 bp. Do you think I should have changed the other parameters then? I should use the parameters...
Forum: Bioinformatics 12-16-2010, 12:52 AM
Replies: 11
Views: 4,142
Posted By khb
So the conclusion is to use this parameters: ...

So the conclusion is to use this parameters:
bowtie hg19 -q input.fastq -m 1 -S bowtie_out
but isn't this the same as
bowtie hg19 -q input.fastq -m 1 --best --strata --all -S bowtie_out if the m 1...
Forum: Bioinformatics 12-16-2010, 12:33 AM
Replies: 11
Views: 4,142
Posted By khb
So it will work without the m 1 command?

So it will work without the m 1 command?
Forum: Bioinformatics 12-16-2010, 12:12 AM
Replies: 11
Views: 4,142
Posted By khb
Bowtie parameters

I'm new in next generation sequencing, and I use Bowtie for the first time. Is there someone that know how to get only the sequences that only have one match? I tried this command.
bowtie hg19 -q...
Forum: General 12-15-2010, 11:40 PM
Replies: 1
Views: 2,130
Posted By khb
Question Help with Bowtie, only unique alignments

I'm new in next generation sequencing, and I use Bowtie for the first time. Is there someone that know how to get only the sequences that only have one match? I tried this command.
bowtie hg19 -q...
Showing results 1 to 15 of 15

 


All times are GMT -8. The time now is 02:55 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO