SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 30
Search took 0.00 seconds.
Search: Posts Made By: Nanu
Forum: Bioinformatics 02-16-2015, 07:47 PM
Replies: 12
Views: 9,677
Posted By Nanu
Hi., I would like to denovo assembly of Ion...

Hi.,

I would like to denovo assembly of Ion torrent data. I am trying to use Mira., It ask for manifest file. May i have create the manifest file, if yes please let me know how to develop manifest...
Forum: RNA Sequencing 01-11-2015, 07:45 PM
Replies: 6
Views: 3,046
Posted By Nanu
Greetings to all! I would like to know about...

Greetings to all!

I would like to know about the reads/kmers per transcripts. As the TrinityStats.pl tells the total assembled bases. contig length. no . of transcripts as longest isoform. So I...
Forum: RNA Sequencing 10-28-2014, 08:03 AM
Replies: 5
Views: 2,903
Posted By Nanu
Genomax, I executed the fastqc , fastx and...

Genomax,

I executed the fastqc , fastx and indexing the reference genome through Bowtie. When i executing the tophat2..it created the accepted.bam and unmapped.bam, align-summary.txt, logs etc......
Forum: RNA Sequencing 10-27-2014, 09:04 PM
Replies: 20
Views: 5,999
Posted By Nanu
I download the data from Ensembl. Is it any...

I download the data from Ensembl. Is it any problem in it.
I exceuted the tophat to align against the reference genome. I found the following files:
1. accepted_hits.bam
2. unmapped.bam...
Forum: RNA Sequencing 10-27-2014, 03:56 AM
Replies: 20
Views: 5,999
Posted By Nanu
I exceuted the tophat to align against the...

I exceuted the tophat to align against the reference genome. I found the following files:
1. accepted_hits.bam
2. unmapped.bam
3.junction.bed
4. align.txt

here accepted_hits.bam, size is 1 KB...
Forum: RNA Sequencing 10-17-2014, 10:54 PM
Replies: 11
Views: 2,938
Posted By Nanu
I executed the cufflink, cuffcompare, cuffquant,...

I executed the cufflink, cuffcompare, cuffquant, cuffmerge..then i went onto the cuffdiff..?? I dont have the data for comparison or differential..So, I would like to know about the next step after...
Forum: RNA Sequencing 10-17-2014, 08:11 PM
Replies: 5
Views: 2,903
Posted By Nanu
If RAM is 1GB then what to do?

If RAM is 1GB then what to do?
Forum: RNA Sequencing 10-17-2014, 08:10 PM
Replies: 11
Views: 2,938
Posted By Nanu
Thank you to all of you..Now I would like to know...

Thank you to all of you..Now I would like to know about the next step what should i perform? On other side I would like to do denovo assembly Will you tell me the softwares to generate the assembly.
Forum: RNA Sequencing 10-17-2014, 09:56 AM
Replies: 11
Views: 2,938
Posted By Nanu
As I understood that it needs two .bam file. When...

As I understood that it needs two .bam file. When I got the data I had .fna and .qual file. I converted into fastq. After that I have one bam file. from where I should get another .bam file.
Forum: RNA Sequencing 10-14-2014, 08:59 PM
Replies: 11
Views: 2,938
Posted By Nanu
./cuffdiff transcripts.gtf tophat_bam_sorted.bam ...

./cuffdiff transcripts.gtf tophat_bam_sorted.bam
You are using Cufflinks v2.2.1, which is the most recent release.
Error: cuffdiff requires at least 2 SAM files

I have only 1 bam file...
Forum: Bioinformatics 10-14-2014, 03:43 AM
Replies: 23
Views: 16,410
Posted By Nanu
When I am running the cuffmerge then i got the...

When I am running the cuffmerge then i got the following error. I mentioned the .gtf file name in it which was created by cufflinks

[Tue Oct 14 17:08:29 2014] Beginning transcriptome assembly...
Forum: Bioinformatics 10-13-2014, 01:29 AM
Replies: 45
Views: 14,207
Posted By Nanu
Dear Genomax, When i mentioned the --prefix to...

Dear Genomax,
When i mentioned the --prefix to give the path the it was showing the following:
./tophat --prefix= /home/me/Downloads/bowtie2-2.2.3/bowtei/...
Forum: Bioinformatics 10-12-2014, 08:33 PM
Replies: 37
Views: 29,930
Posted By Nanu
When I use the command reformat.sh in bbtools...

When I use the command reformat.sh in bbtools package I am getting the following error::
java -ea -Xmx200m -cp /home/himanshu/Downloads/me2/bbmap/current/ jgi.ReformatReads -in=reads.fna...
Forum: Bioinformatics 10-09-2014, 09:23 PM
Replies: 45
Views: 14,207
Posted By Nanu
I would like to thanks to everybody, due to them...

I would like to thanks to everybody, due to them i completed the previous steps. Now I need more help. I have done indexing of reference genome by bowtie2-build . Now I am executing tophat 2.0.13 SO,...
Forum: Bioinformatics 10-07-2014, 08:04 PM
Replies: 45
Views: 14,207
Posted By Nanu
I have to do the sequence based triming of...

I have to do the sequence based triming of adapters. Trimmer scripts need .fastq format. Is any other way to convert the .fna and .qual file to trim without any conversion. If conversion needed then...
Forum: Bioinformatics 10-07-2014, 08:03 PM
Replies: 45
Views: 14,207
Posted By Nanu
Ohk I will try BBMap also

Ohk I will try BBMap also
Forum: Bioinformatics 10-07-2014, 08:02 PM
Replies: 45
Views: 14,207
Posted By Nanu
Brushnell, I have to do the sequence based...

Brushnell,

I have to do the sequence based triming of adapters. Trimmer scripts need .fastq format.
Forum: Bioinformatics 10-07-2014, 09:22 AM
Replies: 45
Views: 14,207
Posted By Nanu
Thanks Genomax, I tried the NGSQC toolkit...

Thanks Genomax,

I tried the NGSQC toolkit for quality control. Please guide me how to convert .fna file to fastq file. On otherside I am installing Tophat..too. I installed Boost then I got msg...
Forum: Bioinformatics 10-01-2014, 05:32 AM
Replies: 45
Views: 14,207
Posted By Nanu
As administrator and I have to learn the RNA seq...

As administrator and I have to learn the RNA seq data analysis. I am new for NGS analysis. I performed firstly fastqc then I got the failure of k-mer & duplication level and warning for per base...
Forum: Bioinformatics 09-30-2014, 07:58 PM
Replies: 45
Views: 14,207
Posted By Nanu
Genomax... Firstly I was facing the error as i...

Genomax...
Firstly I was facing the error as i discussed with you. In this forum I understood about the binaries files when I checked for bin folder was there...Then i tried to execute it from...
Forum: Bioinformatics 09-30-2014, 07:45 AM
Replies: 45
Views: 14,207
Posted By Nanu
I am compiling on 0.0.13 version of fastx...with...

I am compiling on 0.0.13 version of fastx...with the libgtextutils 0.6 version. Now what should I do ?
Forum: Bioinformatics 09-30-2014, 02:39 AM
Replies: 13
Views: 31,772
Posted By Nanu
I have Illumina Seq data Data format: ...

I have Illumina Seq data
Data format:

@HWI-1KL139:40:C0BW5ACXX:1:1102:19408:132180 1:N:0:
TGAACGGACTGGAAACACTGGTCATAATCATGGTGGCGAATAAGTACGCGTTCTTGCAAATCACCAGAAGGCGGTTCCTG
AATGAATGGGAAGCCTTCAAG...
Forum: Bioinformatics 09-30-2014, 01:59 AM
Replies: 13
Views: 31,772
Posted By Nanu
I ran : ./fastx_trimmer -t 30 -i <filename> -o...

I ran :
./fastx_trimmer -t 30 -i <filename> -o <filename2>

fastq_to_fasta -h -r -v -i <filename.fastq> -o <filename.fasta>

No I didnt use any flag.
I am new for this..so please guide me how...
Forum: Bioinformatics 09-30-2014, 01:57 AM
Replies: 13
Views: 31,772
Posted By Nanu
I ran : ./fastx_trimmer -t 30 -i <filename> -o...

I ran :
./fastx_trimmer -t 30 -i <filename> -o <filename2>
No I didnt use any flag.
I am new for this..so please guide me how to use -Q33 flag.
Forum: Bioinformatics 09-30-2014, 01:41 AM
Replies: 13
Views: 31,772
Posted By Nanu
When I am running the command for fastq trimmer...

When I am running the command for fastq trimmer in fastx toolkit..it was showing the error :

fastx_trimmer: Invalid quality score value (char '(' ord 40 quality value -24) on line 8

Please...
Showing results 1 to 25 of 30

 


All times are GMT -8. The time now is 10:59 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO