SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read


Page 1 of 5 1 23 Last »
Showing results 1 to 25 of 119
Search took 0.01 seconds. Search: Posts Made By: arkilis
Forum: Bioinformatics 09-22-2015, 06:36 PM
Replies: 2
Views: 1,051
Posted By arkilis
Question Thanks for your answer. NIPH == National...

Thanks for your answer. NIPH == National Institute of Public Health. which make a lot of senses.

So what does the metadata mean here?
Forum: Bioinformatics 09-22-2015, 05:49 PM
Replies: 2
Views: 1,051
Posted By arkilis
What is the meaning of NIPH in Acinetobacter_sp._NIPH_298 ?

Sry about this stupid question.

I saw there are lots of Acinetobacter species on nicb ftp. If I want to do the diversity profiling, should I download all the Acinetobacter* data?

Thanks,
Forum: Bioinformatics 09-13-2015, 04:14 PM
Replies: 19
Views: 6,234
Posted By arkilis
I just met this problem recently and I solved...

I just met this problem recently and I solved this by checking CASAVA 1.8.2 manual.

Solution for people who needs this:

There might be many reasons lead to such an error.

If the error msg is...
Forum: Bioinformatics 08-27-2015, 11:29 PM
Replies: 3
Views: 1,140
Posted By arkilis
Wink Thanks. Looks like flash2 do the similar job of...

Thanks. Looks like flash2 do the similar job of PEAR.
Forum: Bioinformatics 08-26-2015, 10:29 PM
Replies: 3
Views: 1,140
Posted By arkilis
Does anyone use PEAR before

I am trying to merge two illumina reads set, R1 and R2. However R1 has one particular read named read1 which can NOT be found in R2.

The file after merging only contains part of read1. So how to...
Forum: Sanger/Dye Terminator 08-17-2015, 06:05 PM
Replies: 1
Views: 5,662
Posted By arkilis
why Hairspin region will affect the PCR product

Hi,

I am doing a primer design recently, and using the primer 3 to do the primer design. But get a warning at the end:

CGGCGCCGAGCCCCGCCGGGGTGAGCTGGG


Which looks like a CGG Hairspin. Many...
Forum: Bioinformatics 07-21-2015, 06:36 PM
Replies: 6
Views: 1,742
Posted By arkilis
Clear the data of a teammate who suddenly left....

Clear the data of a teammate who suddenly left. The folder name is E.coli. There are some sequences over there.:rolleyes:

Thank you.
Forum: Bioinformatics 07-21-2015, 04:57 PM
Replies: 6
Views: 1,742
Posted By arkilis
Thank you GenoMax, so there is no generic one for...

Thank you GenoMax, so there is no generic one for alignment. I cannot find the person who submit the sequence, he left without a doc. So I was thinking to download all of them and align them one by...
Forum: Bioinformatics 07-20-2015, 10:16 PM
Replies: 6
Views: 1,742
Posted By arkilis
Which E. coli genome should I use

Hi guys,

There are a couple of genome sequence (rearrangement?) for E. Coli on the NCBI FTP. i.e.

Escherichia_coli_0127_H6_E2348_69_uid32571/
Escherichia_coli_042_uid40647/...
Forum: Bioinformatics 06-18-2015, 05:26 PM
Replies: 1
Views: 1,433
Posted By arkilis
Is there any cattle SNP database avaiable? Thanks

Hi,

I am looking for SNP database for cattle, not quite sure is there any available so far? Much appreciated!:)
Forum: Bioinformatics 04-30-2015, 05:55 PM
Replies: 0
Views: 1,269
Posted By arkilis
using primer3+ design primers received a warning?

When I use primer3+ to do the primer design. It gives out a warning:

Checking for poly-A and poly-T regions >= 7 bp, and potential hairpins ( >= 85% GC in a 30 bp window):

Amplimer 1: Poly-A...
Forum: Bioinformatics 02-02-2015, 04:42 PM
Replies: 2
Views: 1,890
Posted By arkilis
Qualimap gives out detailed mapping info but...

Qualimap gives out detailed mapping info but failed to generate things like which read has been mapped to which sequence.

Thanks a lot! :)
Forum: Bioinformatics 02-02-2015, 04:16 PM
Replies: 2
Views: 1,890
Posted By arkilis
Any tool to review the maps statistics?

Hi all,

Anyone can sugguest one tool to give out statistics on the sam/bam files?
I tried the samtools flagstat to do this, but it only generate very limited information here.

It will be great...
Forum: Bioinformatics 01-22-2015, 07:38 PM
Replies: 64
Views: 38,638
Posted By arkilis
How to use the bbsplit to check the match...

How to use the bbsplit to check the match details.

i.e. I might want to know the 1 seq from my reads match which seq in the ref? Is it possible to do that?

Cheers,
a
Forum: Bioinformatics 01-14-2015, 08:03 PM
Replies: 0
Views: 818
Posted By arkilis
Anyone knows which software can create this image?

https://dl.dropboxusercontent.com/u/24879560/Capture.JPG


It is about the KIR gene diversity.

Thanks in advance.
Forum: Bioinformatics 01-14-2015, 07:44 PM
Replies: 0
Views: 744
Posted By arkilis
How to detect the Allelic polymorphism of a batch of sequences data?

Is there anyway to detect the Allelic polymorphism of a batch of kir genes of sequence data?

Not sure I am asking in the right way. Correct me if you think I am wrong.:)
Forum: Bioinformatics 01-12-2015, 09:47 PM
Replies: 6
Views: 1,798
Posted By arkilis
Finally I used the command you suggested: ...

Finally I used the command you suggested:

bbsplit.sh in1=read1.fastq in2=read2.fastq ref=KIR_nuc.fasta outu1=no_match_1.fq outu2=no_match_2.fq outm1=matched_to_KIR1.fq outm2=matched_to_KIR2.fq
...
Forum: Bioinformatics 01-12-2015, 04:20 PM
Replies: 4
Views: 1,194
Posted By arkilis
Thumbs up Thanks mate!

Thanks mate!
Forum: Bioinformatics 01-12-2015, 03:13 PM
Replies: 4
Views: 1,194
Posted By arkilis
Thanks GenoMax again. You helped me on the other...

Thanks GenoMax again. You helped me on the other question. I might want to find out the all kir genes in a batch of sequence data.

When I go the the ftp site, I found kir_nuc.fasta and many other...
Forum: Bioinformatics 01-11-2015, 10:49 PM
Replies: 4
Views: 1,194
Posted By arkilis
What is the diff between kir3ds1_gen kir3ds1_nuc

I am currently doing the kir alignment, but found there are two nucleotide sequence files on ftp://ftp.ebi.ac.uk/pub/databases/ipd/kir/ for a specific a locus:

i.e. kir3ds1_gen and kir3ds1_nuc....
Forum: Bioinformatics 01-11-2015, 05:19 PM
Replies: 6
Views: 1,798
Posted By arkilis
Sorry for the confusion. KIR gene from...

Sorry for the confusion.

KIR gene from www.ebi.ac.uk/ipd/kir in fasta format. I might want to use this as the database to find out how many of them are in the current sequence files. I read some...
Forum: Bioinformatics 01-11-2015, 04:04 PM
Replies: 6
Views: 1,798
Posted By arkilis
Thanks GenoMax. I tried the whole weekend....

Thanks GenoMax.

I tried the whole weekend. BBSplit/BBMap looks like a alignment tool. I have the KIR gene database, need to get the what it has (KIR) in the sequence files. Any clue on this?
...
Forum: Bioinformatics 01-08-2015, 05:41 PM
Replies: 6
Views: 1,798
Posted By arkilis
how to use mafft do find out kir genes?

recently get a batch of data from miseq, is there way to use mafft to find those kir genes?

I searched online for mafft usage, which looks no where to put kir databases.
...
Forum: Bioinformatics 10-27-2014, 07:39 PM
Replies: 4
Views: 1,403
Posted By arkilis
You are right. Mr. Genius! Just get confirmed...

You are right. Mr. Genius! Just get confirmed with client. MiSeq.
Forum: Bioinformatics 10-27-2014, 06:25 PM
Replies: 4
Views: 1,403
Posted By arkilis
Thanks for answering. One example line here...

Thanks for answering.

One example line here is :

@M00474:102:000000000-A9000:1:1101:19225:1361 1:N:0:1...
Showing results 1 to 25 of 119
Page 1 of 5 1 23 Last »

 


All times are GMT -8. The time now is 09:10 PM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO