SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 116
Search took 0.01 seconds.
Search: Posts Made By: pengchy
Forum: Bioinformatics 06-30-2016, 03:10 AM
Replies: 3
Views: 4,450
Posted By pengchy
Hi, the problem is caused by the redundancy of...

Hi, the problem is caused by the redundancy of the QTL file. There are many line with the same start and end position, if you using the abbreviation as ID, there will be all the same, just like the...
Forum: Bioinformatics 12-03-2015, 07:33 PM
Replies: 2
Views: 2,149
Posted By pengchy
Hi JonB, Have you resolved this problem? I...

Hi JonB,

Have you resolved this problem? I have encountered the same problem. But I can run the gamp without error on one compute node, but with problem on another compute node. Is this caused by...
Forum: Bioinformatics 09-04-2015, 07:32 AM
Replies: 5
Views: 3,986
Posted By pengchy
Yes, I have tested this on...

Yes, I have tested this on tophat-2.0.13.Linux_x86_64/tophat successfully.
Forum: Bioinformatics 06-02-2015, 05:04 PM
Replies: 18
Views: 14,042
Posted By pengchy
Maybe we just need a more work to sort the bam...

Maybe we just need a more work to sort the bam file according to read name "samtools sort -n"
Forum: Bioinformatics 05-03-2015, 03:33 AM
Replies: 8
Views: 8,120
Posted By pengchy
great work! Thank you roryk.

great work! Thank you roryk.
Forum: Bioinformatics 04-28-2015, 02:50 AM
Replies: 3
Views: 3,549
Posted By pengchy
What use of MEDIAN_CV_COVERAGE

According to the definition, MEDIAN_CV_COVERAGE is "The median CV of coverage of the 1000 most highly expressed transcripts. Ideal value = 0." I think the variation should be very large, because...
Forum: Bioinformatics 04-27-2015, 04:59 AM
Replies: 4
Views: 4,166
Posted By pengchy
The problem still exist for cufflinks version...

The problem still exist for cufflinks version 2.2.1. I checked One example that one gene without any reads hit, be reported FPKM 0. However, not all genes without any reads hit were reported. How to...
Forum: RNA Sequencing 04-26-2015, 02:03 AM
Replies: 1
Views: 1,714
Posted By pengchy
please take a look at filtercuffcompare from ...

please take a look at filtercuffcompare from seqscripts: https://github.com/roryk/seqscripts#filtercuffcompare

I have searched around found nobody has used this script here. I have tested this...
Forum: Bioinformatics 04-21-2015, 04:37 PM
Replies: 6
Views: 8,345
Posted By pengchy
Just to remind that this method will not give the...

Just to remind that this method will not give the coverage of the exons of one gene.

coverageBed -abam CCE.bam -s -b mm9.refSeq.Wholegene.bed > CCEcoverage.txt

The percentage coverage given by...
Forum: Bioinformatics 04-16-2015, 07:35 PM
Replies: 132
Views: 54,388
Posted By pengchy
Hi Martin, Thanks for your reply. For...

Hi Martin,

Thanks for your reply.

For the first question, I have initialize a issue at github: https://github.com/marcelm/cutadapt/issues/120

For the second question, It just like the first...
Forum: Bioinformatics 04-16-2015, 07:29 AM
Replies: 132
Views: 54,388
Posted By pengchy
Hi Martin, Just another question when I...

Hi Martin,

Just another question when I using cutadapt. I want to cut the polyA/T for the PacBio sequences. One example here:

@c42683/f1p3/2901...
Forum: Bioinformatics 04-16-2015, 07:23 AM
Replies: 132
Views: 54,388
Posted By pengchy
OK, I will create one issue there. Because I have...

OK, I will create one issue there. Because I have write a perl script to do the work quick and dirt. Just follow the logic that:
First using blat locate the primer position; Second delete the primer...
Forum: Bioinformatics 04-14-2015, 06:16 PM
Replies: 132
Views: 54,388
Posted By pengchy
Hi Martin, Great software! I want to...

Hi Martin,

Great software!

I want to use cutadapt for PacBio CCS data. However, the CCS data have the adaptor/primer in the middle of the long sequence, just like the following example:
...
Forum: Bioinformatics 11-15-2014, 12:35 AM
Replies: 5
Views: 3,986
Posted By pengchy
try to change "bt2" into "bt2l" in the tophat...

try to change "bt2" into "bt2l" in the tophat source file.
Forum: Bioinformatics 08-14-2014, 07:13 PM
Replies: 2
Views: 4,234
Posted By pengchy
The same question, more detail: I have the...

The same question, more detail:

I have the gene ontology annotation file in obo format and gene association file in gaf2 format. I want to visualize them with the purpose:
1. how many and what...
Forum: Bioinformatics 07-12-2014, 04:14 PM
Replies: 1
Views: 2,903
Posted By pengchy
Hi uqfgaiti, have a look at this link: ...

Hi uqfgaiti,

have a look at this link:
http://www.broadinstitute.org/gsea/doc/GSEAUserGuideTEXT.htm#_Preparing_Data_Files
For customized species, you can create your own gene set files for...
Forum: Bioinformatics 07-12-2014, 07:55 AM
Replies: 8
Views: 3,131
Posted By pengchy
thank you kmcarr, as you found, I have wrongly...

thank you kmcarr, as you found, I have wrongly set the quality parameter for tophat2.

Your suggestion is very useful and help me a lot.

Best,
Pengcheng
Forum: Bioinformatics 07-12-2014, 07:13 AM
Replies: 8
Views: 3,131
Posted By pengchy
Hi kmcarr, thank you for the reply. ...

Hi kmcarr, thank you for the reply.

Actually, I have done my work in the steps:
1. mapped fastq of the reads with quality solexa 1.3, like:

@FCC22UBACXX:2:2112:11384:88500#ACACGCGG/1...
Forum: Bioinformatics 07-11-2014, 07:16 AM
Replies: 8
Views: 3,131
Posted By pengchy
Thank kmcarr and blancha's reply. More...

Thank kmcarr and blancha's reply.

More question:
When I use the fastq with the base quality like this:

@FCC22UBACXX:2:1101:1463:2233#ACACGCGG
TGGTCTTCTAAATATTGTCTGAGGGCTCCGTAAGCCTGTGTTTTAGCAC...
Forum: Bioinformatics 07-11-2014, 12:10 AM
Replies: 8
Views: 3,131
Posted By pengchy
base quality encoding changed after tophat2 mapping

fastq

@FCC22UBACXX:2:1101:1463:2233#ACACGCGG/1
TGGTCTTCTAAATATTGTCTGAGGGCTCCGTAAGCCTGTGTTTTAGCAC
+
___acdeegee[efghgbbhgfdehhhfffffhZa^fggbaefhhghhh


after tophat2 mapping, the fastq base...
Forum: RNA Sequencing 10-20-2013, 08:02 PM
Replies: 6
Views: 2,549
Posted By pengchy
Hi all, this problem seems still unresolved....

Hi all,

this problem seems still unresolved.
GTF was recommended by Tophat2 paper if available.
In my case, only one line has the problem in one bam file:

73 scaffold210 ...
Forum: Bioinformatics 09-05-2013, 06:27 PM
Replies: 9
Views: 16,538
Posted By pengchy
I understand this, there only output one record...

I understand this, there only output one record for multiple mapped reads.
Forum: Bioinformatics 09-05-2013, 06:18 PM
Replies: 9
Views: 16,538
Posted By pengchy
Hi, still question here: for this pair...

Hi,

still question here:
for this pair reads, i have sort the bam by the query name, they were uniquely and properply mapped. However, with 0 mapQ. According to the above mentioned method, they...
Forum: Bioinformatics 08-19-2013, 01:25 AM
Replies: 1
Views: 1,704
Posted By pengchy
The .juncs file is not the same as the .bed file...

The .juncs file is not the same as the .bed file from TopHat output in the following:
1. they are in different format.
2. .juncs files only contain the coordination and score, the block length has...
Forum: Bioinformatics 08-18-2013, 08:24 PM
Replies: 5
Views: 5,654
Posted By pengchy
There is a bug for sam_juncs script, which is 1...

There is a bug for sam_juncs script, which is 1 smaller than the output of bed_to_juncs script.
here is the example:
output of sam_juncs

Scaffold184317 456 11046 +
Scaffold184317 11239 ...
Showing results 1 to 25 of 116

 


All times are GMT -8. The time now is 02:10 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO