SEQanswers

Go Back   SEQanswers > Search Forums
Reload this Page Search Results
Register FAQ Members List Calendar Search Today's Posts Mark Forums Read


Page 1 of 4 1 23 Last »
Showing results 1 to 25 of 78
Search took 0.01 seconds. Search: Posts Made By: AnushaC
Forum: Bioinformatics 02-03-2017, 07:42 PM
Replies: 0
Views: 1,144
Posted By AnushaC
Pandas Dataframe For Close Matching Rows Based On A Column Value Range

Hi All,

I have a CSV file which I read as pandas data frame.


Unnamed: 0 X.1 X mz mzmin mzmax rt rtmin \
1 2 643 643 100.111244 100.109215 ...
Forum: Bioinformatics 06-04-2016, 02:18 PM
Replies: 1
Views: 1,528
Posted By AnushaC
I am looking for a command line tool

I am looking for a command line tool
Forum: Bioinformatics 06-04-2016, 02:10 PM
Replies: 1
Views: 1,528
Posted By AnushaC
Secondary Structure Finding in Python/Biopython

Dear All,


Is there a tool that can find all the secondary structures in a string/DNA sequence using python/Biopython



Thanks,
Anusha
Forum: Bioinformatics 05-16-2016, 10:38 PM
Replies: 3
Views: 3,657
Posted By AnushaC
Hi, I did read the link you mentioned which...

Hi,

I did read the link you mentioned which gives an example of cross dimer

iii) Cross Dimer: Primer cross dimers are formed by intermolecular interaction between sense and antisense primers,...
Forum: Bioinformatics 05-16-2016, 05:07 PM
Replies: 3
Views: 3,657
Posted By AnushaC
Difference Between Cross Homology and Cross Dimer In A PCR Primer

Dear All,

What is the difference between cross homology and cross dimer in a PCR primer and can you give one example of each of those.



Thanks,
Anusha
Forum: Bioinformatics 04-03-2016, 01:11 PM
Replies: 0
Views: 667
Posted By AnushaC
Two Substring matched element position in a list

Hi,


>>> l1
['Anushaabcdis', 'bcdef', 'ushaabcdisAn']
>>> l2
['An', 'test']
>>> l3
['ab', 'is']
Forum: Bioinformatics 03-26-2016, 10:30 PM
Replies: 2
Views: 1,623
Posted By AnushaC
Melting Temperature Problems When Calling Working Python Program Through BASH/(***)

Hi,

I have a working python program that also calculates melting temperature of the primer that I am calling through bash.

I am getting errors like while I am running bash script but not while...
Forum: Bioinformatics 03-26-2016, 03:20 PM
Replies: 3
Views: 1,392
Posted By AnushaC
In BASH splitting into substring based on pattern(or) last occurrence of a digit (**)

Hi,

I am trying to split string into substring based on pattern in bash (or) based on last occurance of a digit
y=`echo "AB097865ATCTCTAGCAGTGGCGCCCGAACAGGGCACGCGAA"|grep...
Forum: Bioinformatics 01-09-2016, 04:42 AM
Replies: 2
Views: 2,762
Posted By AnushaC
Python ternary operator Without Else

Dear All,

Is there a ternary operator without else in python

foo = "True" if test else "False"

is there a way

foo = "True" if test == 'True'
Forum: Bioinformatics 11-07-2015, 06:32 PM
Replies: 0
Views: 1,167
Posted By AnushaC
Handling Ties To Get Top N elements in a list in python

Hi,

I want to handle ties while getting top N elements in a list in python and I want include duplicates also if it matches the top value

For example

[1,2,2,4,5,5,6,10] I have a list like...
Forum: Bioinformatics 10-29-2015, 10:38 PM
Replies: 2
Views: 907
Posted By AnushaC
Storing Result Of Python Command Into a Variable

Dear All,

How would I store the result of python command into a variable

>>> x2
'foo'
>>> print (x2)
foo

How would I store a print (x2) into a variable x3
Forum: Bioinformatics 10-29-2015, 02:04 PM
Replies: 2
Views: 2,601
Posted By AnushaC
regex.match in python

Dear All,

I want to search a substring in a string allow certain number of mismateches

I have two strings

>>> S1
'ATAGCACTGC'
>>> S2
'ACAGCATTGC'
Forum: Bioinformatics 10-19-2015, 08:29 PM
Replies: 1
Views: 758
Posted By AnushaC
Find The Database for HIV-pol,env and gag regions separately

Dear All,


Does anybody know how to retrieve HIV pol,env and gag regions separately for several HIV Isolates. I don't want complete genome, but I want separate FASTA files for the above-mentioned...
Forum: Bioinformatics 06-19-2015, 09:48 PM
Replies: 0
Views: 849
Posted By AnushaC
error snpEff annotated VCF hwe(****)

Dear All,

I am trying to annotate my vcf file using java -jar SnpSift.jar hwe
achimmiri@idash-cloud-979:/mnt/oncogxB/anusha/snpEff$ java -jar SnpSift.jar hwe
Usage: java -jar SnpSift.jar hwe...
Forum: Bioinformatics 06-15-2015, 11:39 PM
Replies: 1
Views: 1,215
Posted By AnushaC
freebayes installation problems(*****)

Dear All,

I installed freebayes

achimmiri@idash-cloud-979:/mnt/oncogxA/anusha/DGFDATA_Tissue_DATA/CD4/freebayes$ ls
bamtools examples Makefile ...
Forum: Bioinformatics 12-04-2014, 12:38 PM
Replies: 0
Views: 782
Posted By AnushaC
NGSPipeline::Pipeline::Mapping

Dear All,
Is there any perl built in library/package like this
use NGSPipeline::Pipeline::Mapping;
If so what it is used for ?. Could any body give me documentation or examples of...
Forum: Bioinformatics 06-26-2014, 09:01 PM
Replies: 14
Views: 3,994
Posted By AnushaC
I still not able to figure out what is the exact...

I still not able to figure out what is the exact format for interval list . I tried every thing so far none of them worked . I checked my dict file my header is exactly same as dict filr
but I am...
Forum: Bioinformatics 06-26-2014, 08:45 PM
Replies: 14
Views: 3,994
Posted By AnushaC
achimmiri@idash-cloud-707:/mnt/oncogxA/anusha/DGFD...

achimmiri@idash-cloud-707:/mnt/oncogxA/anusha/DGFDATA_Tissue_DATA/intersectalltissues$ head test1.subtract.interval_list
chr1 LN:249250621 564490 564532
chr1 LN:249250621 564533 564534...
Forum: Bioinformatics 06-26-2014, 09:34 AM
Replies: 14
Views: 3,994
Posted By AnushaC
@HD VN:1.0 SO:unsorted ...

@HD VN:1.0 SO:unsorted
@SQ SN:chr1 LN:249250621 UR:file:/raid/references-and-indexes/hg19/hg19_lite/hg19_lite.fa M5:1b22b98cdeb4a9304cb5d48026a85128...
Forum: Bioinformatics 06-26-2014, 09:15 AM
Replies: 14
Views: 3,994
Posted By AnushaC
1 564490 564532 + target_1 ...

1 564490 564532 + target_1
1 564533 564534 + target_2
1 564672 564718 + target_3
1 564720 564721 + target_4
1 564722 564724 + target_5
1 564739 564741 + target_6
1 564771 564774 + target_7...
Forum: Bioinformatics 06-26-2014, 09:05 AM
Replies: 14
Views: 3,994
Posted By AnushaC
chr1 564490 564532 chr1 564533 564534 ...

chr1 564490 564532
chr1 564533 564534
chr1 564672 564718
chr1 564720 564721
chr1 564722 564724
chr1 564739 564741
chr1 564771 564774
chr1 564776 564807
##### ERROR MESSAGE: Badly formed...
Forum: Bioinformatics 06-26-2014, 08:58 AM
Replies: 14
Views: 3,994
Posted By AnushaC
It is not working I did like this ...

It is not working I did like this
chr1:564490-564532 + target_1
chr1:564533-564534 + target_2
chr1:564672-564718 + target_3
chr1:564720-564721 + target_4
chr1:564722-564724 + target_5...
Forum: Bioinformatics 06-25-2014, 05:17 PM
Replies: 14
Views: 3,994
Posted By AnushaC
I tried this header too @HD VN:1.0 SO:unsorted ...

I tried this header too
@HD VN:1.0 SO:unsorted
@SQ SN:chr1 LN:249250621 /mnt/idash/Genomics/data_ressources/references-and-indexes/hg19/hg19_lite/hg19_lite.fa M5:1b22b98cdeb4a9304cb5d48026a85128...
Forum: Bioinformatics 06-25-2014, 05:16 PM
Replies: 14
Views: 3,994
Posted By AnushaC
GATK interval_list file header format and errors

Hi All,
I am trying to use GATK unified genotyper with -L option. The command works fine with out option but failing with L option.
##################
@HD VN:1.0 SO:unsorted...
Forum: Bioinformatics 06-18-2014, 08:01 AM
Replies: 3
Views: 2,935
Posted By AnushaC
Hi, Thanks it is working . Bam header is...

Hi,
Thanks it is working . Bam header is not sorted that why it give segmentation error .
Showing results 1 to 25 of 78
Page 1 of 4 1 23 Last »

 


All times are GMT -8. The time now is 08:41 PM.

Contact Us - SEQanswers Home - Archive - Top

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO