
Go Back   SEQanswers > Search Forums

Showing results 1 to 25 of 69
Search took 0.01 seconds.
Search: Posts Made By: jdk787
Forum: Bioinformatics 04-02-2020, 11:39 AM
Replies: 19
Views: 438
Posted By jdk787
For MiSeq data, MiSeq Reporter and I think...

For MiSeq data, MiSeq Reporter and I think BaseSpace don't include the index sequence in the headers.
Forum: Bioinformatics 04-02-2020, 09:03 AM
Replies: 19
Views: 438
Posted By jdk787
If you look at the DemultiplexSummaryF1L1.txt it...

If you look at the DemultiplexSummaryF1L1.txt it will tell you what barcodes were used on the run if the demultiplexing worked.

It's located at
<run folder>\Data\Intensities\BaseCalls\Alignment
Forum: Illumina/Solexa 03-05-2020, 04:02 PM
Replies: 3
Views: 494
Posted By jdk787
Correct, I think 10X says to do 28 cycles for R1,...

Correct, I think 10X says to do 28 cycles for R1, then 8 for i7, then 90 or however many cycles you have left for the insert read in R2
Forum: Sample Prep / Library Generation 10-30-2019, 02:22 PM
Replies: 2
Views: 1,093
Posted By jdk787
I have seen many PCR Free protocols recommend two...

I have seen many PCR Free protocols recommend two cleanups to be sure to get rid of any unincorporated adapters which are hard to detect and known to cause index hopping.

This could also be...
Forum: Illumina/Solexa 10-23-2019, 04:01 PM
Replies: 6
Views: 1,130
Posted By jdk787
It's likely that you are just sequencing off of...

It's likely that you are just sequencing off of the end of the library, since your read length is longer than most of your inserts with adapter on the end.

Why use 300 cycles when you largest...
Forum: Illumina/Solexa 04-27-2019, 01:52 PM
Replies: 3
Views: 1,676
Posted By jdk787
This true of libraries with Y shaped adapters...

This true of libraries with Y shaped adapters prior to PCR, but after PCR won't there also be strands that contain the complements to the original adapter sequences? So for a double stranded library...
Forum: Illumina/Solexa 04-10-2019, 04:49 PM
Replies: 3
Views: 1,006
Posted By jdk787
Yes, I have actually designed custom dual index...

Yes, I have actually designed custom dual index primers that work on our MiSeq (NovaSeq style) but not on our MiniSeq (HiSeqX style).

I would first look at your I5 oligo sequence and compare...
Forum: Illumina/Solexa 04-10-2019, 04:05 PM
Replies: 3
Views: 1,006
Posted By jdk787
The I5 index chemistry for the HiSeqX is...

The I5 index chemistry for the HiSeqX is different from the NovaSeq. For standard TruSeq style adapters the I5 sequence on the HiSeqX will be the reverse complement of what it is for the NovaSeq.
Forum: Sample Prep / Library Generation 08-27-2018, 07:41 PM
Replies: 12
Views: 78,333
Posted By jdk787
Forum: Epigenetics 05-18-2018, 03:05 PM
Replies: 17
Views: 10,605
Posted By jdk787
@Castrolsc The digestion profile will vary by...

@Castrolsc The digestion profile will vary by sample type, but it looks like the digestion for your Sperm DNA worked fine. There is material in the range you need for library generation, and the...
Forum: Metagenomics 04-15-2018, 09:49 AM
Replies: 13
Views: 5,636
Posted By jdk787
It looks like your Q scores have a big drop at...

It looks like your Q scores have a big drop at ~80bp which indicates that you have a lot of smaller than expected library fragments. Since you are sequencing v3-v4 libraries I would guess this is due...
Forum: Illumina/Solexa 02-17-2018, 06:21 AM
Replies: 5
Views: 1,340
Posted By jdk787
This has happened to me with the MiSeq and it was...

This has happened to me with the MiSeq and it was a problem with the sample sheet that kept the run from demuxing. If this is what happened then the error log will tell you which lines of your sheet...
Forum: RNA Sequencing 09-27-2017, 06:18 AM
Replies: 7
Views: 1,554
Posted By jdk787
Take a look at this thread, it addresses the same...

Take a look at this thread, it addresses the same issue you are having.

After trimming the adapters on the MiSeq you are left with short...
Forum: Illumina/Solexa 09-25-2017, 11:41 AM
Replies: 3
Views: 1,672
Posted By jdk787
Hello Svitlana I looked at this sequence from...

Hello Svitlana
I looked at this sequence from your other post and the reverse complement matches TruSeq Process controls CTA-150bp, CTA-450bp,...
Forum: Illumina/Solexa 09-22-2017, 05:22 PM
Replies: 11
Views: 1,545
Posted By jdk787
Looks like the reverse complement of #3...

Looks like the reverse complement of #3 (GCGGCCGCGATATCCTGCAGATGCATCCAGTACTAGTATGGCCC) matches the last 55 base of TruSeq process controls CTA-150bp, CTA-450bp, CTA-550bp, and CTA-850bp
Forum: Bioinformatics 09-19-2017, 07:44 AM
Replies: 5
Views: 1,411
Posted By jdk787
It looks like the index sequences in your sample...

It looks like the index sequences in your sample sheet are in the wrong orientation. The demux report shows that the reverse complement of your sample sheet index sequences is what was found in your...
Forum: Sample Prep / Library Generation 08-12-2017, 08:12 AM
Replies: 11
Views: 3,664
Posted By jdk787
Those peaks are most likely leftover primers,...

Those peaks are most likely leftover primers, which should not be a problem since they won't cluster.
Forum: Illumina/Solexa 05-10-2017, 07:19 PM
Replies: 2
Views: 2,299
Posted By jdk787
A single index run will read the I7 index

A single index run will read the I7 index
Forum: Illumina/Solexa 04-20-2017, 11:45 AM
Replies: 5
Views: 1,444
Posted By jdk787
I don't have any hands on experience with the...

I don't have any hands on experience with the NextSeq, but there seems to be a tendency for NextSeq data to have more polyG sequences in R2 than in R1. Possibly due to some inefficiency in the Read 2...
Forum: General 03-27-2017, 07:59 PM
Replies: 2
Views: 1,261
Posted By jdk787
Forum: Bioinformatics 02-10-2017, 07:11 PM
Replies: 4
Views: 3,052
Posted By jdk787
It looks like you are trimming paired end files...

It looks like you are trimming paired end files in single end mode.
Try switching to paired end mode when trimming.

From Cutadapt User Guide
cutadapt -a ADAPTER_FWD -A ADAPTER_REV -o...
Forum: General 02-04-2017, 12:20 PM
Replies: 4
Views: 2,684
Posted By jdk787
Have you tried using Galaxy? ...

Have you tried using Galaxy?
Forum: Illumina/Solexa 02-01-2017, 07:12 PM
Replies: 14
Views: 3,846
Posted By jdk787
If you mean that your library inserts will...

If you mean that your library inserts will contain inline barcodes (I assume at the beginning of your R1 and R2 read) that you will use to demultiplex, then yes you can omit the index read.
Forum: Bioinformatics 01-21-2017, 04:25 PM
Replies: 10
Views: 4,170
Posted By jdk787
Interesting tool. Can you elaborate on what you...

Interesting tool.
Can you elaborate on what you mean by adapters breaking off and ligating to other libraries? Where and how do you think this happens?
Forum: Sample Prep / Library Generation 01-18-2017, 11:34 AM
Replies: 10
Views: 2,844
Posted By jdk787
You could do PCR first and then the gel cut. This...

You could do PCR first and then the gel cut. This would allow you to see if there is any DNA present, and if it is the correct size for what you are selecting for.
Showing results 1 to 25 of 69


All times are GMT -8. The time now is 09:11 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO