SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 3 of 3
Search took 0.00 seconds.
Search: Posts Made By: abbecker
Forum: Oxford Nanopore 09-05-2019, 04:36 AM
Replies: 2
Views: 4,232
Posted By abbecker
I am having the same problem. I want to feed...

I am having the same problem. I want to feed isothermal amplification products to the MinION, but these are all single stranded and >50kb. And no, I can not use a reverse primer, because the...
Forum: Illumina/Solexa 01-18-2018, 09:11 AM
Replies: 1
Views: 1,326
Posted By abbecker
Sequencing using P7 adaptor

Illumina (MiSeq):

Let' say I have multiple amplicon samples, generated by PCR, that look like:

P7Adapt - pad - Index - pad - GenSpecificPrimerF - ...... - GenSpecificPrimerR - pad - Index2 -...
Forum: Illumina/Solexa 01-11-2018, 01:34 AM
Replies: 0
Views: 1,105
Posted By abbecker
Custom Sequencing Primers

Hello,
are there any Illumina sequencing read primers that differ in thier last 13 bp?

Would

Read1 (from TruSeq):
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Read 2 (from Nextera Transposase...
Showing results 1 to 3 of 3

 


All times are GMT -8. The time now is 04:30 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO