SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 17 of 17
Search took 0.00 seconds.
Search: Posts Made By: lix
Forum: Bioinformatics 11-01-2014, 08:04 PM
Replies: 0
Views: 1,582
Posted By lix
Question Did anyone success in working with the broad ABSOLUTE?

Recently I have tried the broad ABSOLUTE package several times with my exome-seq data and noticed that it can also be run under the GenePattern public server. I feed it with my copy-number segmented...
Forum: Bioinformatics 07-24-2014, 06:00 PM
Replies: 3
Views: 1,970
Posted By lix
Jeremy, thanks. I basically checked SNPeff and it...

Jeremy, thanks. I basically checked SNPeff and it looks it can tell how the amino acid changes, and output the length of the changed amino acids length.

I wonder whether SNPeff has the choice to...
Forum: Bioinformatics 07-22-2014, 11:44 PM
Replies: 3
Views: 1,970
Posted By lix
How to get the mutated protein sequence from the DNA mutation information?

I've got the DNA mutation information which can be in a file format like VCF or MAF. Actually what I want to look at is how the mutation influence the corresponding amino acid changes.

Are there...
Forum: Bioinformatics 04-15-2012, 07:05 AM
Replies: 2
Views: 4,521
Posted By lix
MNase-seq data analysis

Hi,

Has anyone ever played with the MNase-seq datasets?
I got some mouse datasets running but there seems several points should take into consideration:
1. repetitive region: as about 50% of...
Forum: Bioinformatics 10-08-2010, 11:55 PM
Replies: 19
Views: 5,664
Posted By lix
Hi adameur, Do the SplitSeek and the AB WT...

Hi adameur,

Do the SplitSeek and the AB WT analysis pipeline support the paired-end SOLiD data?


lix
Forum: Literature Watch 10-08-2010, 05:47 PM
Replies: 2
Views: 6,167
Posted By lix
Does MapSplice support SOLiD data?

Does MapSplice support SOLiD data?
Forum: Bioinformatics 08-14-2010, 05:54 PM
Replies: 15
Views: 7,198
Posted By lix
Wonderful! This is convenient for two files,...

Wonderful!
This is convenient for two files, but what about three or more files?
Forum: Bioinformatics 06-21-2010, 05:14 PM
Replies: 19
Views: 8,689
Posted By lix
Smile Thanks for this convenient tool. It runs...

Thanks for this convenient tool. It runs extremely fast and very easy to use. And, thank John for the very kindful help. :)
Forum: Bioinformatics 06-17-2010, 09:51 PM
Replies: 19
Views: 8,689
Posted By lix
OK, thank you so much.

OK, thank you so much.
Forum: Bioinformatics 06-17-2010, 09:44 PM
Replies: 19
Views: 8,689
Posted By lix
Hi, Thanks for this good tool. It's very fast...

Hi,
Thanks for this good tool. It's very fast and easy to use. But it seems that I did something wrong when I used it.
I followed the tutorial as the website describes and edited the run.cfg file...
Forum: RNA Sequencing 01-29-2010, 05:59 PM
Replies: 155
Views: 65,481
Posted By lix
Hi Xi, Thank you for your so kind reply. ...

Hi Xi,

Thank you for your so kind reply.

My mapped reads are the "eland" format like this:
26 CCTTTCCACATCTTTCTCCCTCGCT U1 0 1 1 chr12 81865484 R
...
Forum: SOLiD 01-28-2010, 09:35 PM
Replies: 34
Views: 29,999
Posted By lix
Hi mmuratet, I collected the raw datasets...

Hi mmuratet,

I collected the raw datasets from the SRA on NCBI website. All the raw reads are generated from the ABI Solid platform and are all in color space which are also the fastq-like format....
Forum: RNA Sequencing 01-27-2010, 08:54 PM
Replies: 155
Views: 65,481
Posted By lix
DEGseq err

Hi Xi,

I'm trying to use DEGseq and my RNA-seq reads have already mapped. The results are the "eland" format. Does DEGseq support this kind of format?

I just follow these commands as the manual...
Forum: SOLiD 12-24-2009, 03:09 AM
Replies: 34
Views: 29,999
Posted By lix
Hi BENN Thank you for your script. I tried...

Hi BENN

Thank you for your script. I tried your SOLiD2Std.pl with my following data like this:

@exa1
T1011122220100230032132.2111111002.1
+
!)+%.*%*+2'0%%%-%+%*5'%!%9+'%+<+0%!%
@exa2...
Forum: Bioinformatics 09-24-2009, 05:12 AM
Replies: 514
Views: 225,982
Posted By lix
Ben, thanks for your so kind reply. I'm also...

Ben, thanks for your so kind reply. I'm also wondering whether the "-3" option for the length of reads setting is correct. For example, if the length of my reads is 36bp and I want to the length just...
Forum: Bioinformatics 09-24-2009, 03:59 AM
Replies: 514
Views: 225,982
Posted By lix
Hi Ben, Thank you for Bowtie. It seems to be...

Hi Ben,

Thank you for Bowtie. It seems to be widely used and I am running it recently. There are some option settings I'm confused and I hope you can give me some kind suggestions:

I am mapping...
Forum: Bioinformatics 09-06-2009, 02:38 AM
Replies: 1
Views: 2,268
Posted By lix
Question Confusion about the use of Bowtie software

I am a new user of the Bowtie software.
For this software, there are so many option parameter settings, so which options should we usually consider or choose?
Thanks.
Showing results 1 to 17 of 17

 


All times are GMT -8. The time now is 07:43 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO