SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 34
Search took 0.00 seconds.
Search: Posts Made By: milesgr
Forum: Bioinformatics 01-23-2014, 05:24 AM
Replies: 1
Views: 1,457
Posted By milesgr
GATK variant calling statistics...

Hi all,
We are calling variants on partial exome data using GATK. We want to see what fraction of our samples have a particular variant. As constituted, GATK will give us the set of samples...
Forum: Bioinformatics 12-13-2013, 09:10 AM
Replies: 7
Views: 10,405
Posted By milesgr
Thanks for the info - it was very helpful. As a...

Thanks for the info - it was very helpful. As a follow-up, I used the following command:
cutadapt -e 0.05 -a TGGAATTCTCGGGTGCCAAGG 001.fastq > 001_CLIPPED.fastq

I found the output was still...
Forum: Bioinformatics 12-13-2013, 06:40 AM
Replies: 7
Views: 10,405
Posted By milesgr
Trimming adapter sequence in the middle of a read

I am analyzing microRNA sequencing data (50 BP/read, single end, Illumina) and I have a sequence like this:

TAGTAGGTTGCATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG

The underlined portion is standard...
Forum: Bioinformatics 04-22-2013, 05:02 AM
Replies: 2
Views: 1,146
Posted By milesgr
Having the same problem, any suggestions?

Having the same problem, any suggestions?
Forum: Bioinformatics 03-27-2013, 05:54 AM
Replies: 0
Views: 869
Posted By milesgr
Finding common genomic regions...

I have used VarScan to identify CNVs in whole exome data using tumor and matching normal. I have four patients - two that respond to treatment, and two that do not. We are looking for CNVs common to...
Forum: Bioinformatics 03-06-2013, 10:55 AM
Replies: 20
Views: 9,534
Posted By milesgr
I know this thread is a bit old, but I tried...

I know this thread is a bit old, but I tried using ExomeCNV as well and also get 0 in the average coverage column. Did anyone figure out why this occurs? Thanks! :)
Forum: Bioinformatics 10-16-2012, 05:44 AM
Replies: 6
Views: 1,587
Posted By milesgr
So I used tophat 2 to align the data. I used...

So I used tophat 2 to align the data. I used multiple cores but ran it on the default settings.

I have tumor and normal samples (no replicates, single end).

My accepted_hits.bam for the normal...
Forum: Bioinformatics 08-17-2012, 07:24 AM
Replies: 1
Views: 991
Posted By milesgr
GATK question

This is probably a simple question, but I aligned several files using BWA, I then merged the BAM files and sorted them using samtools. I am now trying to run GATK using a simple CountReads function....
Forum: Bioinformatics 08-10-2012, 11:37 AM
Replies: 1
Views: 2,710
Posted By milesgr
Transcriptome...

Sorry for the easy question...where can I find a human transcriptome reference sequence? I don't see anything at the UCSC downloads site that resembles this. Thanks.
Forum: Bioinformatics 08-09-2012, 06:55 AM
Replies: 6
Views: 1,587
Posted By milesgr
Thanks for the suggestions...I would like to...

Thanks for the suggestions...I would like to stick with BWA....downloading only RNA sequences will cause novel genes to not align correctly. Any other thoughts?
Forum: Bioinformatics 08-09-2012, 05:12 AM
Replies: 6
Views: 1,587
Posted By milesgr
Simple RNA-Seq alignment question...

I aligned RNA-Seq reads to the reference genome. However, reads that span splice junctions will not align. What is the best way to handle this? I've read that aligning to a reference transcriptome is...
Forum: Bioinformatics 07-02-2012, 08:33 AM
Replies: 5
Views: 2,478
Posted By milesgr
Got it working using: sh "/filepath/test.sh...

Got it working using:

sh "/filepath/test.sh $i1" | qsub -q queue_name -l nodes=1:ppn=8

Not positive why I had to go about it in such a roundabout way.
Forum: Bioinformatics 06-28-2012, 10:44 AM
Replies: 5
Views: 2,478
Posted By milesgr
Anyone? :)

Anyone? :)
Forum: Bioinformatics 06-27-2012, 10:15 AM
Replies: 5
Views: 2,478
Posted By milesgr
Qsub bwa pipeline...

This may seem like a relatively easy question, but here goes:

I am trying to create a relatively simple shell script that sits in a parent folder, goes through all subfolders, grabs all files with...
Forum: Bioinformatics 08-04-2011, 11:36 AM
Replies: 10
Views: 4,257
Posted By milesgr
Has anyone resolved this issue with regards to...

Has anyone resolved this issue with regards to paired-end colorspace data?
Forum: General 07-07-2011, 06:05 AM
Replies: 2
Views: 4,257
Posted By milesgr
ROOT install + CNVnator issues

I received a pm from user antimony with the following but he did not allow private message responses, so I figured I'd post it here and hope he sees it.




I remember what the problem was - the...
Forum: Bioinformatics 06-06-2011, 12:50 PM
Replies: 70
Views: 59,350
Posted By milesgr
I had a problem when running this workflow and...

I had a problem when running this workflow and was wondering if someone could help me solve this problem. It appears as if the chromosome lengths for chromosomes 14 and 10 in the yeast genome are off...
Forum: General 05-31-2011, 07:55 AM
Replies: 9
Views: 2,825
Posted By milesgr
Has anyone had any success with FREEC? This seems...

Has anyone had any success with FREEC? This seems to have the capability to do the trick.
Forum: General 05-31-2011, 07:44 AM
Replies: 9
Views: 2,825
Posted By milesgr
I am interested in finding both, but the most...

I am interested in finding both, but the most important ones we want are nonconcordant CNV's. One twin has cancer, the other does not. We want to know CNV's responsible for this. It also would help...
Forum: General 05-31-2011, 07:36 AM
Replies: 9
Views: 2,825
Posted By milesgr
Here is the error: Assuming BAM file ... ...

Here is the error:

Assuming BAM file ...
terminate called after throwing an instance of 'std::bad_alloc'
what(): St9bad_alloc...
Forum: General 05-31-2011, 07:36 AM
Replies: 9
Views: 2,825
Posted By milesgr
I have data from whole genome sequencing done...

I have data from whole genome sequencing done using 90 bps paired-end reads. I have aligned it using bowtie with parameters specified by the authors of CNVer, who have suggested a CNV-focused...
Forum: General 05-31-2011, 05:05 AM
Replies: 9
Views: 2,825
Posted By milesgr
That looks very bare-bones but seems workable as...

That looks very bare-bones but seems workable as long as you know what you're doing. Have you had any success running this? Do you think it would work for whole-genome sequencing input? Also, what...
Forum: General 05-31-2011, 03:47 AM
Replies: 9
Views: 2,825
Posted By milesgr
CNV between twins...

I am looking to use a CNV tool to find CNV between twins (not just between a single sequence and a reference genome. I am attempting to use CNVnator, which is supposed to be the most accurate CNV...
Forum: Bioinformatics 05-30-2011, 06:53 PM
Replies: 39
Views: 15,239
Posted By milesgr
Never mind, I figured it out. If anyone needs...

Never mind, I figured it out. If anyone needs help, please feel free to post here.
Forum: Bioinformatics 05-30-2011, 05:58 PM
Replies: 39
Views: 15,239
Posted By milesgr
How did you get root to install? After like 15...

How did you get root to install? After like 15 minutes, I got the following:


/usr/bin/ld: /usr/local/lib/libfftw3.a(map-r2r-kind.o): relocation R_X86_64_32S against `a local symbol' can not be...
Showing results 1 to 25 of 34

 


All times are GMT -8. The time now is 06:44 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO