SEQanswers

Go Back   SEQanswers > Search Forums


Showing results 1 to 25 of 29
Search took 0.01 seconds.
Search: Posts Made By: tomc
Forum: Bioinformatics 02-09-2017, 12:16 PM
Replies: 7
Views: 5,717
Posted By tomc
Q. Should I use unix commands or python scripts?...

Q. Should I use unix commands or python scripts?

A. Yes.


A less misunderstandable answer is; it all depends on your current situation.

A ready made script in any language with extra...
Forum: Bioinformatics 03-28-2016, 01:21 PM
Replies: 3
Views: 1,294
Posted By tomc
Variable substitution ...

Variable substitution

foo="AB097865ATCTCTAGCAGTGGCGCCCGAACAGGGCACGCGAA"
echo ${foo##*[0-9]}
ATCTCTAGCAGTGGCGCCCGAACAGGGCACGCGAA
Forum: Bioinformatics 02-16-2016, 12:34 PM
Replies: 9
Views: 17,273
Posted By tomc
Sequence of blast results

Lets try saying it this way.

Don't extract sequences from your blast results.

Extract a list of sequence identifiers (top hit perhaps) from your blast results.
Then use that list of...
Forum: Bioinformatics 04-05-2015, 01:45 PM
Replies: 6
Views: 3,478
Posted By tomc
quokka we will not know your cluster's file...

quokka we will not know your cluster's file system or network setup but in general you want the data and the search to be as close as possible, and you want to reuse the data on hand as much as...
Forum: Bioinformatics 11-25-2014, 11:28 PM
Replies: 6
Views: 1,674
Posted By tomc
how about just start very simple and subtract one...

how about just start very simple and subtract one from the other.

maybe take the absoute value of the resulting ...heatmap

then look at the rows or columns and sum what you find in each
from...
Forum: General 11-06-2014, 03:38 PM
Replies: 2
Views: 1,336
Posted By tomc
sed 's/^>\([^_]*\)_/>barcodelabel=\1;\1_/g'...

sed 's/^>\([^_]*\)_/>barcodelabel=\1;\1_/g' sample.fna > sample.rename.fna

Should work for any number of sample names as long as they are
between a leading ">" and followed with underscore. ...
Forum: Bioinformatics 11-06-2014, 01:04 PM
Replies: 7
Views: 5,717
Posted By tomc
Hi kenietz Since each data set can be one or...

Hi kenietz

Since each data set can be one or many sequences of any lenght,
the question remains less than fully specified,
but under the assumption that both datasets are composed of many...
Forum: General 09-26-2014, 01:16 AM
Replies: 10
Views: 2,699
Posted By tomc
Greg Wilson's Software Carpentry is designed to...

Greg Wilson's Software Carpentry is designed to help people in your position.
Contact them, and convince your University to invite them down for a bootcamp
but in the meanwhile they have their...
Forum: General 09-26-2014, 01:02 AM
Replies: 4
Views: 1,550
Posted By tomc
As dpryan said those are small enough not to...

As dpryan said those are small enough not to matter what you use, whatever is comfortable.
( and we did not mean the sample you posted
but the few hundred square matricies you mention)

If you...
Forum: Bioinformatics 12-15-2012, 12:29 AM
Replies: 9
Views: 7,352
Posted By tomc
grep your sequence & sort results by length is a...

grep your sequence & sort results by length is a start
Forum: Bioinformatics 06-28-2012, 08:09 AM
Replies: 7
Views: 5,028
Posted By tomc
ncbi blast has start & end parameters to...

ncbi blast has start & end parameters to retrieve subseuences
Forum: Bioinformatics 04-26-2012, 10:27 PM
Replies: 7
Views: 5,717
Posted By tomc
for two datasets A & B where records a are in...

for two datasets A & B
where records a are in dataset A and records b are in dataset B

Blast query a against target dataset B to obtain best hit b'
Blast query b' against target dataset A to...
Forum: Illumina/Solexa 04-17-2012, 05:57 PM
Replies: 8
Views: 8,282
Posted By tomc
thanks for expansion.

thanks for expansion.
Forum: Illumina/Solexa 04-17-2012, 09:20 AM
Replies: 8
Views: 8,282
Posted By tomc
Thanks makes sense, I had not realised both top &...

Thanks makes sense, I had not realised both top & bottom surfaces were imaged.

So signal from the clusters on the opposite surface of the glass are avoided
somehow, depth of field?
Forum: Illumina/Solexa 04-16-2012, 08:58 PM
Replies: 8
Views: 8,282
Posted By tomc
tile nomenclature

I am learning about Illumina (HiSeq2000?) data files by poking around a run,
and am wondering why the tiles are labelled the way they are.

My understanding is a lane is composed of 48...
Forum: Bioinformatics 04-07-2012, 11:54 PM
Replies: 5
Views: 1,496
Posted By tomc
I have used bowtie --best -strata ... in...

I have used
bowtie --best -strata ...

in that situation with success
Forum: Bioinformatics 04-07-2012, 11:44 PM
Replies: 5
Views: 2,223
Posted By tomc
again assuming there are no 'X' in your read...

again assuming there are no 'X' in your read names (that you care about):

tr -d X reads.fa > filtered_reads.fa
Forum: Bioinformatics 04-07-2012, 11:34 PM
Replies: 5
Views: 5,111
Posted By tomc
blast knows nothing of chromosomes so it they are...

blast knows nothing of chromosomes so it they are in a blast report it is because you happened to have a blast database constructed from fasta file with Chr info in the their defline ( the line above...
Forum: Bioinformatics 01-02-2012, 10:51 PM
Replies: 9
Views: 4,400
Posted By tomc
the question will need more background/context...

the question will need more background/context information where ever it ends up.

starting with basic information such as your data sources ...
Forum: Bioinformatics 10-24-2011, 10:48 PM
Replies: 1
Views: 2,048
Posted By tomc
include a RNG of your choice instead of the built...

include a RNG of your choice instead of the built in ones if they are insufficient
there many to choose from. Maybe a "Mersenne twister" here is an implementation ...
Forum: Bioinformatics 09-21-2011, 10:13 PM
Replies: 4
Views: 2,288
Posted By tomc
There is a perl "fastagrep" that might help if...

There is a perl "fastagrep" that might help if you have a fasta version of your transcriptome

http://nebc.nox.ac.uk/scripts/parse/fastagrep
Forum: General 08-04-2011, 11:58 PM
Replies: 11
Views: 5,034
Posted By tomc
dying? hopefully not before we have sequenced...

dying?
hopefully not before we have sequenced the troll genome ...
mods you show great restraint
Forum: Bioinformatics 05-15-2011, 11:21 PM
Replies: 8
Views: 2,050
Posted By tomc
you want to copy your query over your...

you want to copy your query over your reference...?

If so, why not just pull you query sequence and use those,
they already have the gaps you seem to be looking for.

But it does sound odd,...
Forum: Bioinformatics 04-25-2011, 10:12 PM
Replies: 2
Views: 2,563
Posted By tomc
you are looking for resource managers and batch...

you are looking for resource managers and batch schedulers
Torque and Maui are good places to start your search
Forum: Bioinformatics 03-25-2011, 10:04 AM
Replies: 2
Views: 1,178
Posted By tomc
If it helps, here is a shell script to truncate ...

If it helps, here is a shell script to truncate reads at the first B score


fastq_trim_B.awk

#! /usr/bin/nawk -f
# tomc
# trim trailing 'B' scores (and sequence) from Ilumina FastQ reads...
Showing results 1 to 25 of 29

 


All times are GMT -8. The time now is 05:18 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO